Search
Search
Nature of the Insert
The cloning of PCR-amplified fragments into a linear vector is typically a rapid and efficient process. However, not all PCR fragments will clone with the same efficiency into the same vector. These differences may be due to fragment size, insert toxicity, and the complexity of the insert. Inverted, AT-rich, or GC-rich repeats may contribute to the instability of the fragment as a cloned product in any vector (pCR®II, pCR®2.1, pcDNA™3.1, pUC18).
Insert Size
The size of the fragment being cloned is a primary contributor to the overall cloning efficiency. Large fragments of DNA (≥ 5 kb) are amenable to cloning in high-copy number vectors, yet at a much lower efficiency.
Vector-to-Insert Ratio
Optimization of molar concentration ratios of the vector to insert is critical to ensure efficient cloning. Successful cloning ratios may range from 1:1 to 1:10. One common strategy for determining the optimal ratio is by preparing several vector: insert ratios: 1:1, 1:3, and 1:5. While these ratios may not be ideal for all cloning events, they are useful for most cloning needs. For example, if the vector is 3 kb and the insert is 1 kb, one-third the amount of insert needs to be added to attain a 1:1 molar ratio. When performing TOPO® -TA or Directional TOPO® Cloning, optimal results are achieved most often when using a 1:10 dilution of the PCR product.
Fresh PCR Product
The use of fresh PCR products in TA, TOPO® TA, and Directional TOPO® Cloning is recommended due the potential presence of exonucleases that will, over time, degrade the nucleotide overhangs, reducing the efficiency of the cloning event. While it is not recommended, some PCR products have been successfully cloned after 1 week of storage at +4°C.
Importance of Positive and Negative Controls
In any cloning experiment, the use of positive and negative controls is important. Without appropriate positive and negative controls for your cloning and transformation reactions, it is very difficult to evaluate the results of a cloning event. These controls are indicators of enzyme activity in DNA preparation and transformation efficiency of competent cells. Troubleshooting is virtually impossible without any controls. To ensure the efficiency of the cloning reaction, each of our kits includes controls.
Compatibility of DNA Ends of Vector and Insert
TA Cloning® technology was designed to clone PCR products produced by Taq polymerase. It takes advantage of the terminal transferase activity of this polymerase which adds a single 3’-A overhang to each end of the PCR product. Blunt cloning vectors and directional TOPO® cloning technologies are designed to clone PCR products produced by proofreading polymerases. Successful cloning depends upon using the correct polymerase with your cloning vector.
Addition of 3’-A Overhangs Following PCR Amplification
Direct cloning of DNA amplified by proofreading polymerases into TA Cloning®or TOPO TA Cloning® vectors is often difficult because of very low cloning efficiencies. This is because proofreading polymerases possess 3´→5´ exonuclease activity that removes the 3´-A overhangs necessary for TA Cloning® and TOPO TA Cloning®. A simple procedure to add 3´ adenines to blunt-end fragments is provided below. Other protocols may be suitable.
You will need the following items:
Note: If you have more than one PCR product, you may wish to gel-purify your fragment using the S.N.A.P.™ MiniPrep Kit. After purification, add Taq polymerase buffer, dATP, and 0.5 unit of Taq polymerase, and incubate 10-15 minutes at 72°C. Proceed directly to the cloning reaction.
Designing the Forward PCR Primer for Directional TOPO®Cloning
Successful directional TOPO® Cloning depends on the design of the forward PCR primer and, to a lesser extent, on the design of the reverse PCR primer. To clone directionally, the forward PCR primer must contain a simple Kozak sequence (CACCATG) at the 5´ end of the primer. The four nucleotides, CACC, base pair with the overhang sequence, GTGG. The bold ATG is the initiation codon of your protein of interest.
Designing the Reverse PCR Primer
To ensure that your ORF clones directionally with high efficiency, the reverse PCR primer must not be complementary to the overhang sequence GTGG at the 5´ end. A one base pair mismatch will reduce the directional cloning efficiency to 75%, and may result in your ORF being cloned in the opposite orientation. We have not observed any evidence of PCR products cloning in the opposite orientation because of a two base pair mismatch, but this has not been tested directly. Other options to consider are listed in Table 1.
Table 1 - Options to consider when designing the reverse PCR primer
| Option | Action |
|---|---|
| Include the C-terminal tag encoded by the vector | Design your reverse PCR primer so that your ORF is in frame with the C-terminal tag and does not contain a stop codon |
| Omit the C-terminal tag encoded by the vector | Design your reverse PCR primer to include a stop codon or design it to anneal downstream of the native stop codon |
| Use another C-terminal tag | Design your reverse PCR primer to contain the tag of interest and include a stop codon to prevent inclusion of the C-terminal tag |
| Secrete your PCR product using mammalian or insect Gateway®native expression vectors | Use the pENTR™/D-TOPO® vector and include the appropriate secretion signal |
In addition to the major considerations above, you may have other options to consider depending on the directional cloning vector you are using. Please refer to the respective manuals for detailed information.
Competent Cells
The competence of a microorganism is dependent on its ability to uptake recombinant DNA and survive the introduction of foreign DNA into the cell. Different organisms vary in these capacities, however the basic principles of introduction are the same. Modifications to the cell membrane/wall of microorganisms must occur often, using either chemical modification or electric shock. After this damage, cells are recovered and calculated for their “uptake” efficiency—measured as colony forming units per microgram of DNA (cfu/μg). Some common transformation efficiencies are listed below in Table 1.
Table 1 - Transformation efficiencies (cfu/μg)
| Chemically Competent | Electrocompetent | |
|---|---|---|
| E. coli | 1.0 x 106 to 5.0 x 109 | 1.0 x 108 to 2.0 x 1010 |
| S. cerevisiae | 1.0 x 103 to 2.2 x 107 | 1.0 x 105 to 1.0 x 107 |
| S. pombe | 1.0 x 103 to 1.0 x 106 | 1.0 x 105 to 1.0 x 106 |
| P. pastoris | 1.0 x 102 to 1.0 x 105 | 1.0 x 104 to 1.0 x 105 |
Transformation Method
We offer chemically competent and electrocompetent E. coli. Chemically competent E. coli have a fragile cell wall which make cells prepared in this manner incompatible with electrocompetent transformation methods where a high-energy field is applied to the cells/DNA mixture. Likewise, our electrocompetent E. coli are not transformable with any heat-shock transformation technique.
Rapid Transformation Procedure for Use with TOPO Vectors
Recommended only for transformations using ampicillin selection.
1. Add 4 μl of the TOPO Cloning reaction to one vial of One Shot® Chemically Competent E. coli and mix gently.
2. Incubate on ice for 5 minutes.
3. Spread 50 μl of cells on a pre-warmed LB plate (containing ampicillin and X-gal) and incubate overnight at 37°C
| Primer | Sequence | Application |
| 3´ AOX1 Pichia | 5´d[GCAAATGGCATTCTGACATCC]3´ | Primer for sequencing from any Pichia expression vector which contains the 3´AOX1 transcription termination sequence. 21mer. |
| 5´ AOX1 Pichia | 5´d[GACTGGTTCCAATTGACAAGC]3´ | Forward primer for sequencing from any Pichia expression vector which contains the 5´AOX1 sequence. 21mer. |
| Ac5 Forward | 5´d[ACACAAAGCCGCTCCATCAG]3´ | Forward primer for sequencing from the pAc5.1/V5-His A, B, & C vectors. 20mer. |
| a-Factor | 5´d[TACTATTGCCAGCATTGCTGC]3´ | Forward primer for sequencing from pPIC9, pPIC9K, pPICZa, and pGAPZa Pichia expression vectors. 21mer. |
| AUG1 Forward | 5´d[CAATTTACATCTTTATTTATTAACG]3´ | Forward primer for sequencing Pichia methanolica expression vectors containing the AUG1 promoter. 25mer. |
| AUG1 Reverse | 5´d[GAAGAGAAAAACATTAGTTGGC]3´ | Reverse primer for sequencing Pichia methanolica expression vectors containing the AUG1 promoter. 22mer. |
| Baculovirus (+15) Reverse | 5´d[ACTTCAAGGAGAATTTCC]3´ | Reverse primer for sequencing from the pBlueBac4.5, pBlueBacHis2, and pMelBac vectors. 18mer. |
| BGH Reverse | 5´d[TAGAAGGCACAGTCGAGG]3´ | Reverse primer for sequencing from vectors which contain the BGH polyadenylation sequence. 18mer. |
| cI Forward | 5´d[GGATAGCGGTCAGGTGTT]3´ | Forward primer for sequencing from the pHybcI/HK vector. 18mer. |
| CMV Forward | 5´d[CGCAAATGGGCGGTAGGCGTG]3´ | Forward primer for sequencing from vectors with the human CMV immediate early promoter. 21mer. |
| CYC1 Reverse | 5´d[GCGTGAATGTAAGCGTGAC]3´ | Reverse primer for sequencing vectors with the CYC1 transcription termination signal. 19mer. |
| EBV Reverse | 5´d[GTGGTTTGTCCAAACTCATC]3´ | Reverse primer for sequencing from all EBV vectors. 20mer. |
| Ecdysone Forward | 5´d[CTCTGAATACTTTCAACAAGTTAC]3´ | Forward primer for sequencing from the pIND or pIND(SP1) expression vectors. 24mer. |
| EF-1a Forward | 5´d[TCAAGCCTCAGACAGTGGTTC]3´ | Forward primer for sequencing from vectors with the human translation elongation factor-1a (EF-1a) promoter. 21mer. |
| GAL1 Forward | 5´d[AATATACCTCTATACTTTAACGTC]3´ | Forward primer for sequencing from vectors with the S. cerevisiae GAL1 promoter. 24mer. |
| M13 Forward (-20) | 5´d[GTAAAACGACGGCCAG]3´ | Universal forward primer for sequencing from any vector containing the N-terminal coding sequence of the lacZ gene. 16mer. |
| M13 Forward (-40) | 5´d[GTTTTCCCAGTCACGAC]3´ | Universal forward primer for sequencing from any vector containing the N-terminal coding sequence of the lacZ gene. 17mer. |
| M13 Reverse | 5´d[CAGGAAACAGCTATGAC]3´ | Universal reverse primer for sequencing from any vector containing the N-terminal coding sequence of the lacZ gene. 17mer. |
| M13/pUC Forward | 5´d[CCCAGTCACGACGTTGTAAAACG]3´ | Forward primer for sequencing from recombinant bacmid in Bac-to-Bac® Baculovirus expression system. 23mer. |
| M13/pUC Reverse | 5´d[AGCGGATAACAATTTCACACAAGG]3´ | Reverse primer for sequencing from recombinant bacmid in Bac-to-Bac® Baculovirus expression system. 23mer. |
| MT Forward | 5´d[CATCTCAGTGCAACTAAA]3´ | Forward primer for sequencing from the pMT/V5-His or pMT/BiP/V5-His vectors. 18mer. |
| OpIE2 Forward | 5´d[CGCAACGATCTGGTAAACAC]3´ | Forward primer for sequencing InsectSelect™ vectors containing a single copy of the OpIE2 promoter. 20mer. |
| OpIE2 Reverse | 5´d[GACAATACAAACTAAGATTTAGTCAG]3´ | Reverse primer for sequencing InsectSelect™ vectors containing the OpIE2 polyadenylation sequence. 26mer. |
| pBAD Forward | 5´d[ATGCCATAGCATTTTTATCC]3´ | Forward primer for sequencing from vectors with the E. coli araBAD promoter. 20mer. |
| pBAD Reverse | 5´d[GATTTAATCTGTATCAGG]3´ | Reverse primer for sequencing from vectors with the E. coli araBAD promoter. 18mer. |
| pCEP Forward | 5´d[AGAGCTCGTTTAGTGAACCG]3´ | Forward primer for sequencing from the pCEP4 vector. 20mer. |
| pGAP Forward | 5´d[GTCCCTATTTCAATCAATTGAA]3´ | Forward primer for sequencing from the glyceraldehyde-3-phosphate dehydrogenase promoter of the pGAPZ and pGAPZa vectors. 22mer. |
| pGENE Forward | 5´d[CTGCTATTCTGCTCAACCT]3´ | Forward primer for sequencing from the pGene/V5-His expression vector. 19mer. |
| pHybLex/Zeo Forward | 5´d[AGGGCTGGCGGTTGGGGTTATTCGC]3´ | Forward primer for sequencing from the pHybLex/Zeo vector. 25mer. |
| pHybLex/Zeo Reverse | 5´d[GAGTCACTTTAAAATTTGTATACAC]3´ | Reverse primer for sequencing from the pHybLex/Zeo vector. 25mer. |
| pJG4-5 Forward | 5´d[GATGCCTCCTACCCTTATGATGTGCC]3´ | Forward primer for sequencing from the pJG4-5 vector. 26mer. |
| pJG4-5 Reverse | 5´d[GGAGACTTGACCAAACCTCTGGCG]3´ | Reverse primer for sequencing from the pJG4-5 vector. 24mer. |
| Polyhedrin Forward | 5´d[AAATGATAACCATCTCGC]3´ | Forward primer for sequencing from any baculovirus transfer vector containing the polyhedrin promoter. 18mer. |
| Polyhedrin Reverse | 5´d[GTCCAAGTTTCCCTG]3´ | Reverse primer for sequencing from any baculovirus transfer vector containing the polyhedrin promoter. 15mer. |
| pREP Forward | 5´d[GCTCGATACAATAAACGCC]3´ | Forward primer for sequencing from the pREP4 vector. 19mer. |
| pRH Forward | 5´d[CTGTCTCTATACTCCCCTATAG]3´ | Forward primer for sequencing from the pRH5´or pRH3´ vectors. 22mer. |
| pRH Reverse | 5´d[CAAAATTCAATAGTTACTATCGC]3´ | Reverse primer for sequencing from the pRH5´or pRH3´ vectors. 22mer. |
| pTrcHis Forward | 5´d[GAGGTATATATTAATGTATCG]3´ | Forward primer for sequencing from the pTrcHis A, B, & C, pTrcHis2 A, B, & C, pTrcHis-TOPO®, and pTrcHis2-TOPO® vectors. 21mer. |
| pTrcHis Reverse | 5´d[GATTTAATCTGTATCAGG]3´ | Reverse primer for sequencing from the pTrcHis A, B, & C, pTrcHis2 A, B, & C, pTrcHis-TOPO®, and pTrcHis2-TOPO® vectors. 18mer. |
| pUni Forward | 5´d[CTATCAACAGGTTGAACTG]3´ | Forward primer for sequencing from the pUni vectors. 19mer. |
| pUni Reverse | 5´d[CAGTCGAGGCTGATAGCGAGCT]3´ | Reverse primer for sequencing from the pUni vectors. 22mer. |
| pYESTrp Forward | 5´d[GATGTTAACGATACCAGCC]3´ | Forward primer for sequencing from the pYESTrp or pYESTrp2 vectors. 19mer. |
| pYESTrp Reverse | 5´d[GCGTGAATGTAAGCGTGAC]3´ | Reverse primer for sequencing from the pYESTrp or pYESTrp2 vectors. 19mer. |
| Sp6 Promoter | 5´d[GATTTAGGTGACACTATAG]3´ | Universal primer for sequencing from most Sp6 primer sites. 19mer. |
| T3 Promoter | 5´d[ATTAACCCTCACTAAAGGGA]3´ | Universal primer for sequencing from most T3 primer sites. 20mer. |
| T7 Promoter | 5´d[TAATACGACTCACTATAGGG]3´ | Universal primer for sequencing from most T7 primer sites. 20mer. |
| T7 Reverse | 5´d[TAGTTATTGCTCAGCGGTGG]3´ | Reverse primer for sequencing from T7 expression vectors. 20mer. |
| V5 Reverse | 5´d[ACCGAGGAGAGGGTTAGGGAT]3´ | Reverse primer for sequencing from vectors encoding the C-terminal V5 epitope. 21mer. |
| Xpress™ Forward | 5´d[TATGGCTAGCATGACTGGT]3´ | Forward primer for sequencing from vectors encoding the Xpress™ epitope. 19mer. |
| Transformation Problem | Possible Cause | Solution |
| Low transformation efficiency | Impurities in the DNA | For chemically competent cells, remove phenol, proteins, detergents, and ethanol from the DNA solution. For electrotransformable cells, ethanol precipitate ligations to clean up plasmid DNA, since salt and buffers severely inhibit electroporation and increase the risk of arcing. In addition, dissolve the DNA in sterile water or 0.5X TE (5 mM Tris-HCl, 0.5 mM EDTA). |
| Low transformation efficiency | Excess DNA or volume | Add 1 to 10 ng of DNA in no more than a 5-µl volume per 100 µl of chemically competent cells. For Subcloning Efficiency™ cells, use 1 to 3 µl per 50 µl of competent cells. For ElectroMAX™ cells, add 1 µl (1 to 50 ng) to 20 to 25 µl of cells. |
| Low transformation efficiency | Inhibition of transformation by ligation | For One Shot®, MAX Efficiency®, Library Efficiency® and Subcloning Efficiency™ cells, dilute the ligation reaction mix 5 times with 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA before adding to competent cells. For UltraMAX™ cells and when using MAX Efficiency® cells for library construction, add = 5 µl of undiluted DNA to 100 µl of cells. |
| Low transformation efficiency | Poor expression of antibiotic resistance | Use S.O.C. medium for expression. Transformation efficiency decreases 2- to 3-fold if expression is performed in LB medium. For Stbl4™ cells and Stbl2™ cells, express for 90 min. instead of 60 min., since the expression is performed at 30°C. |
| Low transformation efficiency | Improper storage of competent cells | Store at -80°C. Our electrotransformable and chemically competent cells are stable for up to 2 years. Do not store cells in liquid nitrogen. Minimize the number of freeze-thaw cycles. Aliquot and refreeze any unused cells. Note, however, it will lower transformation efficiencies. |
| Low transformation efficiency | Improper handling of competent cells | Thaw competent cells on ice, and use cells immediately upon thawing. Do not vortex. |
| Low transformation efficiency | Improper heat-shock procedure for chemically competent cells | For One Shot®, UltraMAX™, MAX Efficiency®, and Library Efficiency® cells, incubate cells at 42°C for 45 sec. without shaking. These conditions are optimized for round-bottom polypropylene tubes (17 to 100 mm) and 100 µl of cells. For Subcloning Efficiency™ cells, incubate cells at 37°C for 20 sec. using 1.5-ml microcentrifuge tubes and 50 µl of cells. For Stbl2™ cells, heat at 42°C for 25 sec. instead of 45 sec. • If there is a change in the tubes or volume of cells, the heat shock conditions must be optimized. |
| Low transformation efficiency | Improper electroporation | Use devices that apply 16 kV/cm and the appropriate conditions for each electrocompetent strain. |
| Low transformation efficiency | Slow or no growth of cells | If cells are being grown at 30°C instead of 37°C, incubate for at least 90 min. during recovery and incubate the transformed colonies longer. |
| Low transformation efficiency | Overgrowth (little or no selection) | Be certain that the correct antibiotic is used. Ensure that the correct concentration of antibiotic is used. See recommended usage on page XX. Use fresh antibiotics—make sure the drug is not expired. |
| Low transformation efficiency | Calculations performed improperly | Be certain that correct dilution factors and DNA amounts are used to calculate efficiency. |
| Antibiotics | E. coli | S. cerevisiae | P. pastoris | Yeast General | Mammalian | Insect |
| Actinomycin | 2-5 ug/ml | |||||
| Ampicillin | 25-100 ug/ml | |||||
| Blasticidin | 50 ug/ml | 5-100 ug/ml | 250-300 ug/ml | 2-25 ug/ml | 10-80 ug/ml | |
| Carbenicillin | 10-50 ug/ml | |||||
| Chloramphenicol | 25-170 ug/ml | |||||
| Gentamicin | 5-50 ug/ml | 35 ug/ml | 10 ug/ml | |||
| Hygromycin | 20-200 ug/ml | 50 ug/ml | 50-200 ug/ml | |||
| Kanamycin | 10-50 ug/ml | 10-50 ug/ml | ||||
| Neomycin | 200-300 ug/ml | 50-2500 ug/ml | 500-700 ug/ml | |||
| Spectinomycin | 100 ug/ml | |||||
| Streptomycin | 50-100 ug/ml | |||||
| Tetracycline | 10-50 ug/ml | 1 ug/ml for induction | ||||
| Zeocin | 25-50 ug/ml | 50-300 ug/ml | 300 ug/ml | 5-50 ug/ml | 300-600 ug/ml |
| Strain | Genotype |
| BY4730 | MATα leu2-∆0 met15-∆0 ura3-∆0 |
| BY4739 | MATα leu2-∆0 lys2-∆0 ura3-∆0 |
| BY4741 | MATα his3-∆1 leu2-∆0 met15-∆0 ura3-∆0 |
| BY4742 | MATα his3-∆1 leu2-∆0 lys2-∆0 ura3-∆0 |
| BY4743 | 4741/4742 |
| EBY100 | MATα ura3-52 trp1 leu2∆1 his3∆200 pep4::HIS3 prb1∆1.6R can1 GAL (pIU211: URA3) |
| EGY191 | MATα ura3 trp1 his3 2lexAop-LEU2 |
| EGY191/pSH18-34 | MATα ura3 trp1 his3 2lexAop-LEU2 {pSH18-34: URA3 8lexAop-lacZ} |
| EGY48 | MATα ura3 trp1 his3 6lexAop-LEU2 |
| EGY48/pSH18-34 | MATα ura3 trp1 his3 6lexAop-LEU2 {pSH18-34: URA3 8lexAop-lacZ} |
| GS115 | his4 |
| INVSc1 | MATα/MATa his3∆1/his3∆1 leu2/leu2 trp1-289/trp1-289 ura3-52/ura3-52 |
| KM71 | his4 aox1::ARG4 arg4 |
| KM71H | aox1::ARG4 arg4 |
| L40 | MATa his3∆200 trp1-901 leu2-3112 ade2 LYS2::(4lexAop-HIS3) URA3::(8lexAop-lacZ) GAL4 |
| L40-ura3 | MATα ura3-52 leu2-3112 his3 .200 trp1 .1ade2 LYS2::(LexA op)4-HIS3 ura3::(LexA-op)8-lacZ |
| L40uraMS2 | MATa ura3-52 leu3-3112 his3∆200 trp1∆l ade2 LYS2::(4lexAop-HIS3) ura3::(8lexAop-lacZ) {pLexA/MS2/Zeo (Zeocin™)} |
| PMAD11 | ade2-11 |
| PMAD16 | ade2-11 pep4 prb1 |
| SKY191 | MATα ura3 trp1 his3 2lexAop-LEU2 3cIop-LYS2 |
| SKY48 | MATα ura3 trp1 his3 6lexAop-LEU2 3cIop-LYS2 |
| SKY48/pLacGUS | MATα ura3 trp1 his3 6lexAop-LEU2 3cIop-LYS2 {pLacGUS: URA3 3cIop-gusA 8lexAop-lacZ} |
| SMD1168 | pep4 his4 |
| SMD1168H | pep4 |
| TCP | h- leu1-32 |
| X-33 | wild-type |
| Genotype | Description |
|---|---|
| ara-14 | Blocks arabinose catabolism |
| argF | Ornithine carbamoyltransferase mutation blocks ability to use arginine |
| dam/dcm | Abolishes endogenous adenine methylation at GATC sequences (dam) or cytosine methylation at CCWGG sequences (dcm). Used to propagate DNA for cleavage with certain restriction enzymes (e.g. Ava II, Bcl I) |
| DE3 | Lysogen that encodes T7 RNA polymerase. Used to induce expression in T7-driven expression systems |
| endA | endA Mutation in the non-specific endonuclease Endonuclease I; eliminates non-specific endonuclease activity, resulting in improved plasmid preps |
| F´ | A self-transmissible, low-copy plasmid used for the generation of single-stranded DNA when infected with M13 phage; may contain a resistance marker to allow maintenance and will often carry the lacI and lacZ∆M15 genotypes |
| galK | Galactokinase mutation blocks catabolism of galactose—cells that are galK minus grow in the presence of galactose as the sole carbon source |
| galU | Glucose-1-phosphate uridylyltransferase mutation blocks ability to use galactose—cells that are galU minus can grow on media that contains galactose as the sole carbon source |
| gyrA96 | DNA gyrase mutant produces resistance to nalidixic acid |
| hsd | Mutations in the system of methylation and restriction that allow E. coli to recognize DNA as foreign. The hsd genotype allows efficient transformation of DNA generated from PCR reactions *hsdR–eliminates restriction of unmethylated EcoK I sites. (1) **hs |
| lacI | Encodes the lac repressor that controls expression from promoters that carry the lac operator; IPTG binds the lac repressor and derepresses the promoter; often used when performing blue/white screening or to control expression of recombinant genes |
| lacY1 | Blocks use of lactose via β-D-galactosidase mutant |
| lacZ | β-D-galactosidase gene; mutations yield colorless (vs. blue) colonies in the presence of X-gal |
| lacZ∆M15 | Element required for β-galactosidase complementation when plated on X-gal; used in blue/white screening of recombinants; usually carried on the lambdoid prophage φ80 or F´ |
| leuB | Requires leucine for growth on minimal media via β-isopropyl malate dehydrogenase mutation |
| lon | lon Deficiency in the Lon ATPase-dependent protease; decreases the degradation of recombinant proteins; all B strains carry this mutation |
| mcrA, mcrBC,or mrr | Mutations that allow methylated DNA to not be recognized as foreign; this genotype is necessary when cloning genomic DNA or methylated cDNA |
| nupG | Mutation for the transport of nucleosides |
| ompT | Indicates that the E. coli lack an outer membrane protease—reduces degradation of heterologous the strains and recovery of intact recombinant proteins is improved in ompT minus strains |
| P3 | A 60-kb low-copy plasmid that carries the ampicillin and tetracycline resistance genes with amber mutations; used predominantly for selection of supF-containing plasmids; carries the kanamycin resistance gene for selection |
| pLys | pLys Plasmid that encodes T7 lysozyme; used to reduce basal expression in T7-driven expression systems by inhibiting basal levels of T7 RNA polymerase |
| proAB | proAB Requires proline for growth on minimal media |
| recA | Mutation in a gene responsible for general recombination of DNA; particularly desirable when cloning genes with direct repeats |
| relA | RNA is synthesized in absence of protein synthesis (relaxed phenotype) relA locus regulates the coupling between transcription and translation. In the wild type, limiting amino acid concentrations results in the shutdown of RNA synthesis (also known as th |
| rpsL | Confers resistance to streptomycin (this makes a mutant ribosomal protein, small subunit, the target of the drug) |
| supE,F | tRNA glutamine suppressor of amber (supE)(UAG) or tyrosine (supF) |
| thi-1 | Requires thiamine for growth on minimal media |
| Tn10 | Confers tetracycline resistance via a transposon |
| tonA | Confers resistance to the lytic bacteriophage T1, T5 and f80 |
| traD, D36 | Prevents transfer of F' episome via transfer factor mutation |
| tsx | Confers resistance to phage T6 and colicin K |
| xyl-5 | Blocks catabolism of xylose |
| Protruding End | Unambiguous | Ambiguous |
| 5´-AATT | Apo I EcoR I Mun I Tsp 509 I | |
| 5´-AGCT | Hind III | |
| 5´-CATG | BspLU11 I Nco I Rca I | Afl III, BsaJ I,Dsa I, Sty I |
| 5´-CCGG | Cfr 10 I, Kpn2 I, PinA I, SgrA I, Xma I | Ava I, BsaJ I |
| 5´-CG | Aci I, BsaH I, Cla I, HinP1 I , Hpa II , Mae II, Msp I, Nar I, Nsp V, Psp1406 I, Taq I | Acc I |
| 5´-CGCG | Asc I, Bss H II, Mlu I | Afl III, BsaJ I, Dsa I |
| 5´-CTAG | Avr II, Nhe I, Spe I, Xba I | BsaJ I, Sty I |
| 5´-GATC | BamH I, Bcl I, Bgl II, Bsp1407 I, Bst Y I, Mbo I, Nde II, Sau 3A I | |
| 5´-GGCC | Eae I, Not I, Xma III | |
| 5´-GTAC | Asp718 I, Sun I | Ban I |
| 5´-GTCAC | Tsp 45 I | |
| 5´-GTGAC | Tsp 45 I | |
| 5´-TA | Mae, Mse I, Nde I, Vsp I | |
| 5´-TCGA | Sal I, Xho I | Ava I |
| 5´-TGCA | Alw 44 I | Sfc I |
| 5´-TTAA | Afl II | |
| ACGT-3´ | Aat II | |
| AGCT-3´ | Sst I | Alw21 I, Ban II |
| AT-3´ | Pac I, Pvu I | |
| ATC-3´ | Sgf I | |
| CATG-3´ | Nla III, Nsp I, Sph I | |
| CG-3´ | Hha I | |
| GC-3´ | Sst II | |
| GCGC-3´ | Bbe I, Hae II | |
| GGCC-3´ | Apa I, Fse I | Ban II, Sdu I |
| GTAC-3´ | Kpn I | |
| TGCA-3´ | Nsi I, Pst I, Sse8387 I | Alw 21, I Sdu I |
| Strain | Genotype |
| BL21 Star™(DE3) | F- ompT hsdSB (rB-, mB-) gal dcm rne131 (DE3) |
| BL21 Star™(DE3)pLysS | F- ompT hsdSB (rB-, mB-) gal dcm rne131 (DE3) pLysS (CamR) |
| BL21(DE3) | F- ompT hsdSB (rB-, mB-) gal dcm (DE3) |
| BL21(DE3)pLysE | F- ompT hsdSB (rB-, mB-) gal dcm (DE3) pLysE (CamR) |
| BL21(DE3)pLysS | F- ompT hsdSB (rB-, mB-) gal dcm (DE3) pLysS (CamR) |
| BL21-AI™ | F- ompT hsdSB(rB-, mB-) gal dcm araB::T7 RNAP-tetA |
| BL21-SI™ | F- ompT hsdSB(rB-, mB-) gal dcm endA1 lon- proUp::T7 RNAP::malQ-lacZ (TetS) |
| DB3.1™ | F- gyrA462 endA ∆(sr1-recA) mcrB mrr hsdS20 (rB-, mB-) supE44 ara14 galK2 lacY1 proA2 rpsL20(Smr ) xyl5 ∆leu mtl1 |
| DH10Bac™ | F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 endA1 recA1 ∆(ara, leu)7697 araD139 galU galK, nupG rpsL λ- |
| DH10B™ | F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galK rpsL(StrR) endA1 nupG |
| DH10B™-T1R | F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 endA1 araD139 ∆(ara, leu)7697 galU galK λ- rpsL nupG tonA |
| DH12S™ | F´ {proAB+ lacIqZ∆M15 Tn10(TetR)} φ80lacZ∆M15 recA1 ∆(mcr-hsdRMS-mcrBC) ∆lacX74 ∆(ara-leu)7697 araD139 galU galK nupG rpsL relA1 |
| DH5α-E™ | F- φ80lacZ∆M15 ∆(lacZYA-argF) U169 endA1 recA1 hsdR17 (rk-, mk+) thi-1 phoA supE44 λ- gyrA96 relA1 gal- |
| DH5αF´IQ™ | F´ proAB+ lacIqZ∆M15 zzf::Tn5 (KmR) φ80lacZ∆M15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ-thi-1 gyr96 relA1 |
| DH5α-FT™ | F´ proAB+ lacIqZ∆M15 Tn10(TetR) φ80lacZ ∆M15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ-thi-1gyrA96 relA1 |
| DH5αMCR™ | F- mcrA ∆(mcr-hsdRMS-mcrBC) φ80lacZM15 (lacZYA-argF) U169 endA1 recA1 supE44 thi-1 gyrA96 relA1 |
| DH5α™ | F- φ80lacZ∆M15 ∆(lacZYA-argF) U169 endA1 recA1 hsdR17 (rk-, mk+) supE44 thi-1 gyrA96 relA1 phoA |
| DH5α™-T1R: | F- φ80lacZM15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 phoA tonA |
| GeneHogs® | F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG fhuA::IS2 |
| GI698 and GI724 | F - λ- lacIq lacPL8 ampC::Ptrp cI Note: GI698 has no ribosome binding site before the cI repressor gene, causing decreased production of cI repressor, when compared to GI724. |
| INV110 | F´ {traD36 proAB+ lacIq lacZ∆M15} rpsL (StrR) thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 ∆(lac-proAB) ∆(mcrC-mrr)102::Tn10 (TetR) |
| INVαF´ | F´ endA1 recA1 hsdR17 (rk-, mk+) supE44 thi-1 gyrA96 relA1 φ80lacZ∆M15 ∆(lacZYA-argF) U169 |
| LMG194 | F- ∆lacX74 galE thi rpsL ∆phoA (Pvu II) ∆ara714 leu::Tn10 (TetR) |
| Mach1™-T1R | F´ φ80(lacZ)∆M15 ∆lacX74 hsdR(rk-, mk+) ∆recA1398 endA1 tonA |
| MC1061/P3 | F- hsdR (rk-, mk+) araD139 ∆(araABC-leu)7679 galU galK ∆lacX74 rpsL (StrR) thi mcrB {P3: KanR AmpR (am) TetR (am)} |
| OmniMAX™-T1R | F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80(lacZ)∆M15 ∆(lacZYA-argF) U169 endA1 recA1 supE44 thi-1 gyrA96 relA1 tonA panD/F' proAB+ lacIq lacZ∆M15 Tn10 (TetR) |
| PIR1 | F- ∆lac169 rpoS(am) robA1 creC510 hsdR514 endA recA1 uidA(∆Mlu I)::pir-116 |
| PIR2 | F- ∆lac169 rpoS(am) robA1 creC510 hsdR514 endA recA1 uidA(∆Mlu I)::pir |
| Stbl2™ | F- mcrA ∆(mcrBC-hsdRMS-mrr) recA1 endA1 lon gyrA96 thi-1 supE44 relA1 λ- ∆(lac-proAB) |
| Stbl4™ | F´ proAB+ lacIqZ∆M15 Tn10(TetR) λ- mcrA ∆(mcrBC-hsdRMS-mrr) recA1 endA1 gal supE44 gyrA96 thi-1 relA1 ∆(lac-proAB) |
| TOP10 | F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG |
| TOP10/P3 | F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆ {P3: KanR AmpR (am) TetR (am)} |
| TOP10F´ | F´{lacIq Tn10(TetR)} mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 araD139 ∆(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG |
| Protruding End | Unambiguous | Ambiguous |
| 5´-AATT | Apo I EcoR I Mun I Tsp 509 I | |
| 5´-AGCT | Hind III | |
| 5´-CATG | BspLU11 I Nco I Rca I | Afl III, BsaJ I,Dsa I, Sty I |
| 5´-CCGG | Cfr 10 I, Kpn2 I, PinA I, SgrA I, Xma I | Ava I, BsaJ I |
| 5´-CG | Aci I, BsaH I, Cla I, HinP1 I , Hpa II , Mae II, Msp I, Nar I, Nsp V, Psp1406 I, Taq I | Acc I |
| 5´-CGCG | Asc I, Bss H II, Mlu I | Afl III, BsaJ I, Dsa I |
| 5´-CTAG | Avr II, Nhe I, Spe I, Xba I | BsaJ I, Sty I |
| 5´-GATC | BamH I, Bcl I, Bgl II, Bsp1407 I, Bst Y I, Mbo I, Nde II, Sau 3A I | |
| 5´-GGCC | Eae I, Not I, Xma III | |
| 5´-GTAC | Asp718 I, Sun I | Ban I |
| 5´-GTCAC | Tsp 45 I | |
| 5´-GTGAC | Tsp 45 I | |
| 5´-TA | Mae, Mse I, Nde I, Vsp I | |
| 5´-TCGA | Sal I, Xho I | Ava I |
| 5´-TGCA | Alw 44 I | Sfc I |
| 5´-TTAA | Afl II | |
| ACGT-3´ | Aat II | |
| AGCT-3´ | Sst I | Alw21 I, Ban II |
| AT-3´ | Pac I, Pvu I | |
| ATC-3´ | Sgf I | |
| CATG-3´ | Nla III, Nsp I, Sph I | |
| CG-3´ | Hha I | |
| GC-3´ | Sst II | |
| GCGC-3´ | Bbe I, Hae II | |
| GGCC-3´ | Apa I, Fse I | Ban II, Sdu I |
| GTAC-3´ | Kpn I | |
| TGCA-3´ | Nsi I, Pst I, Sse8387 I | Alw 21, I Sdu I |
| To Perform a Double Digest | To Perform a Sequential Digest |
| Choose the REact® buffer that has 100% activity for each enzyme. If no single buffer fulfills these requirements, then choose a buffer that ensures the highest activity possible without causing nonspecific cleavage. | Perform the reaction with the restriction endonuclease that requires the lowest salt conditions first. If the enzyme can be heat inactivated, stop the first reaction by heating for 10 minutes at 65°C. Then adjust the salt concentration with minimal increase in volume to approximate the optimal conditions for the second enzyme. Add the second enzyme and perform the reaction. Note: If either enzyme is affected by glycerol, make certain that the glycerol concentration does not exceed 5% when both enzymes are present. |
仅供研究使用,不得用于诊断程序。
