Search
Search
The Invitrogen TrueDesign Genome Editor is a free online tool that enables scientists of all experience levels to easily design, select, and order reagents for accurate and successful gene editing experiments.
| Experiment type | Knockout a target gene | Add a fluorescent or epitope tag | Insert, delete, or replace up to 30 bases | Long insertion up to 10kb | Generate a SNP |
| Description | Insert a stop codon, target a region for indel formation, or utilize the TrueTag Knockout Enrichment Kit | Tag a target gene with less time and effort with TrueTag Donor DNA Kits | In any human, mouse, rat, zebrafish, or roundworm gene using CRISPR-Cas9 or TALEN technology | sequences up to 10 kb with custom length homology arms up to 1 kb using CRISPR-Cas9 or TALEN technology | Introduce a single nucleotide change in your target |
|
We also offer pre-designed synthetic and lentiviral guide RNAs for straightforward knockout of your human or mouse target gene, plus easy online ordering of any custom synthetic sgRNA design.
With TrueDesign, you can:
The TrueDesign tool supports a variety of edits—gene knockout, gene tagging, insertion, replacement, deletion, and SNP creation. For each design, the software compiles a list of the materials you will need for a successful edit, with the convenience of ordering them from one source and the confidence that they will work together. Our research shows that improved design and delivery of gRNA, Cas9 nuclease, and donor DNA can contribute to enhanced CRISPR/Cas9-mediated genome editing.[1]
A Thermo Fisher Scientific account is required, but creating an account and/or signing in is free, quick, and easy.
Don't have an account? Create one today with only your name and email. Other benefits include contracted pricing, online quotes, ability to place and track orders, and earning rewards.
The TrueDesign tool follows a simple, three-step workflow: select your gene and transcript, specify your edit, and design your CRISPR and/or TALEN target from our recommendations. At the end, you’ll see a summary where you can review your design and download a list of materials needed or add them to your cart.
In this example, we’ll add a GFP tag to the N-terminus of the ACTB gene, which encodes the protein actin.
In the Select step, select the type of edit you want to make and identify the species and gene you want to modify. Then select the transcript from the list generated by the TrueDesign tool.
In the Edit step, select the region of code if necessary and specify the details of the modification—in this case, adding a GFP tag to the N-terminus of the ACTB gene. We’ll also insert a selection marker to enrich for successfully tagged cells when we later use puromycin to eliminate unedited cells.
In the Design step, the tool finds and evaluates CRISPR and TALEN targets to accomplish the edit and recommends the best matches with circled green checkmarks. Select the target(s) you want.
TALEN technology is useful when no suitable CRISPR PAM sites are available for your design. It may also be more efficient than CRISPR in editing hard-to-edit genomic regions such as heterochromatin.[2]
Once your design is complete, a Summary lets you review it and lists all materials that are required or recommended to accomplish your edit. You can select the products you want and add them to your cart, or export them to a spreadsheet with complete details of your design and recommended protocol.
This experiment shows the results when the design developed in the extended Workflow example was carried out with U2OS cells, editing the ACTB gene to generate both N- and C-terminal GFP tags for the actin protein. Using the recommended gRNA design GCTATTCTCGCAGCTCACCA (PAM TGG), the forward and reverse primers were used with the TrueTag Donor DNA Kit to amplify a functional donor template. After successful amplification and purification of the donor DNA, it was cotransfected into cells with the gRNA and Cas9 protein.
The microscopy images show U2OS cells expressing GFP-tagged ACTB (green), counterstained with Hoechst nuclear dye (blue). The green actin filaments are clearly visible in the edited cells (B) vs negative controls (A). When puromycin selective pressure is applied to these cell pools, the population of cells can be driven to almost 100% as quantified by flow cytometry. A detailed workflow is described in the TrueTag Donor DNA Kit user guide.
ACTB-tagged cells (green), counterstained with Hoechst dye (blue). (A) Negative control and (B) edited cells showing clear actin filament formation with GFP-ACTB fusion proteins. (C) Summary of three experiments where applying puromycin selection can drive these cell populations to >80% GFP-positive cells for the N-terminal constructs and >99% positive cells for the C-terminal constructs. Images were captured on the Invitrogen EVOS FL Color Imaging System.
Before you begin
1. Is your browser supported? Thermo Fisher Cloud includes the latest data security and display features that require the use of one of the following browsers/versions:
Click on a link above to download and install a compatible browser. Thank you for using Thermo Fisher Cloud.
2. From your supported browser, log in to the Thermo Fisher Cloud using your existing username and password. A verification request email will be sent to the email address on file for your online account. If you don’t immediately receive this verification request, check your spam folder.
Release 6.0 Notes - February 2024
Major features in release 6.0 include the features of prior releases and adds the following capabilities:
Release 5.1 Notes – May 2022
Major features in Release 5.1 include the features of prior releases and add the following capabilities:
Release 4.0 Notes – September 2021
Major features in Release 4.0 include the features of prior releases and add the following capabilities:
Release 3.0 Notes – March 2021
Major features in Release 3.0 include the features of prior releases and add the following capabilities:
Release 2.1 Notes – May 2020
In Release 2.1, minor bugs and usability issues were resolved to support punchout (B2B) ordering.
Release 2.0 Notes – May 2020
Major features in Release 2.0 include the features of Release 1.0 and add the following capabilities:
Release 1.0 Notes – October 2019
The major features in the initial version include:
[1] Liang X, Potter J, Kumar S, Ravinder N, Chesnut JD. Enhanced CRISPR/Cas9-mediated precise genome editing by improved design and delivery of gRNA, Cas9 nuclease, and donor DNA. J Biotechnol. 2107; 241: 136-146. Full text
[2] Jain S, Shukla S, Yang C, et al. TALEN outperforms Cas9 in editing heterochromatin target sites. Nat Commun. 2021: 12: 606. Full text
[3] Chen S, Francioli LC, Goodrich JK, et al. A genomic mutational constraint map using variation in 76,156 human genomes. Nature. 2024;625(7993):92-100. doi:10.1038/s41586-023-06045-0. Full text
[4] McKenna A, Shendure J. FlashFry: a fast and flexible tool for large-scale CRISPR target design. BMC Biol. 2018;16(1):74. Published 2018 Jul 5. doi:10.1186/s12915-018-0545-0. Full text
Discover our comprehensive portfolio of products and services designed to support every step in your genome editing workflow (PDF)
Access genome editing application resources for more success as you plan and execute your experiments.
Getting started with CRISPR-Cas9? Need proven genome editing protocols? Check out our collection of step-by-step and cell-line specific recommendations.
Find answers to everyday problems with our answers to commonly asked questions.
Make a free appointment to connect with one of our technical experts to get started or troubleshoot your genome editing project.
Find tips, troubleshooting help, and resources for your genome editing experiments.
Find experts who can help you with the technical aspects of application and product use.
Learn about commercial opportunities.