Search
Search
View additional product information for Custom TaqMan™ SNP Genotyping Assay, human - FAQs (4331349, 4332072, 4332073)
40 product FAQs found
A reference panel is helpful in large studies to mark your reference samples. Please follow the directions here on how to set up a reference panel.
The polymorphism sequence info can be entered into the software through Setup >Assays. You can import an assay information file (AIF) that contains this info for your assays (AIFs are shipped with assay orders), or manually enter this info for each assay using the edit assay feature. The polymorphism sequence info will be displayed in the assays table under allele1 base and allele2 base, in the results table in the calls column, in the cluster plot display in the x-axis and y-axis titles, and in the export files as genotypes. If no sequence information is entered for an assay, the default display for genotype calls will use the dye names, such as VIC/VIC, VIC/FAM or FAM/FAM dyes.
Bookmarking is a unique feature in TaqMan Genotyper Software that allows you to tag a data point or well while reviewing results in a Study. For example, in reviewing a cluster plot for an assay, a data point is observed to be somewhat between clusters. You can set a bookmark for this data point to denote this well for further investigation. The bookmark persists between the Results workspace and Quality Control workspace, so you can easily identify the data point in a cluster plot, experiment plate view, or on the samples tab. Bookmarks are cleared upon exit from a Study or exit from the application.
1.Go to the Start button, then Programs, then TaqMan Genotyper Software
2.Right-click on the program and choose “Run as Administrator”
3.If that does not work, go back to the same menu and choose “Properties”
4.Choose the “Compatibility” tab, and check “Run this program as administrator”
5.Click “Apply”
6.You may+C69 have to restart the computer for the settings to apply
An assay or sample may be deleted from a study only if there is no data or wells associated with it. Upon import of an experiment, the software collects all the assays and samples from the plate and lists them in the Setup > Assays or Setup > Samples workspaces. The assays and samples are stored in these workspaces as a library, and remain there even if you delete the experiment from the Study. Deleting the experiment will remove any data (wells) associated with the assays or samples, but not the assays or samples from the library. The assays and samples must then be deleted from these workspaces to remove them from the Study.
The software does not allow assay IDs or sample IDs to be modified. If a typing error occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup --> Assays or Setup --> Samples.
Trailing clusters are often due to variation in gDNA quality or concentration. Please see the example here for more details (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/trailing-clusters.html).
Multiple clusters such as in the example below could be due to a hidden SNP under the probe or primer. Search dbSNP (https://www.ncbi.nlm.nih.gov/SNP/) for other SNPs around the target SNP. If the nontarget SNP has a low MAF it will usually not be a problem. If the nontarget SNP is under a primer, try to redesign and mask it as an “N”. Another possibility is that the region is within a copy number variation, in which case you will have to evaluate with a TaqMan Copy Number Assay as well.
Check the Minor Allele Frequency (MAF) of the SNP. You may need a larger sample size in order to see the allele. You can use the Hardy-Weinberg equation to determine if the minor allele is detectable in your sample size or not. Follow the example here (p. 4-2).
Depending on the assay, you may want to try either reducing or increasing the number of cycles. Our newer instrument software can even allow you to view the traces if you collect the real-time data on the instrument.
If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software. This program has an improved algorithm which allows it to make calls that are often missed by the SDS software.
There are several reasons for a SNP assay not amplifying, including:
-DNA may not be accurately quantitated
-Degraded DNA
-Inhibitors in the sample
-Error in reaction setup
Check out our troubleshooting tool for more details at https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/snp-not-amplifying.html.
This could happen if the assay fails functional testing. All human SNP genotyping assays get tested with a panel of human gDNA samples. The assay must show amplification with at least one cluster in order to pass. When there is no amplification you will be notified of the failure and not charged for the assay. The assay may have failed for the following reasons:
-Input sequence was incorrect (cDNA instead of gDNA)
-Input sequence was not human
-Input sequence was not appropriately pre-screened
-Signal from NTC was less than 0.5 units from samples (assay did not give high fluorescence signal)
To resolve this, please consult the guidelines in the Design and Ordering Guide (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf) to properly prepare the sequence for the Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays). If the sequence was not human, make sure to select non-human at the species filter step. Nonhuman assays do not get functionally tested.
Yes, you can analyze a triallelic SNP using paired TaqMan SNP Genotyping Assays. Please refer to this application note for more information (https://tools.thermofisher.com/content/sfs/brochures/cms_055168.pdf).
We do not provide control samples. However, Coriell has a large gDNA repository and you may be able to find controls there. Go to: http://ccr.coriell.org/ and choose “SNP Search”. Enter your rs number or gene name. If there are samples available you will see them in the table, such as in this example below. Browse the different genotypes for your desired controls. If a control is not available, you can have one synthesized using GeneArt Gene Synthesis.
We recommend using either the TaqPath ProAmp Master Mix or the TaqMan Genotyping Master Mix. The TaqMan Genotyping Master Mix has the advantage of proven performance with up to 3 days of pre- and post-PCR stability, allowing you to set up plates ahead of time or read the plates later (see the data here, https://tools.thermofisher.com/content/sfs/brochures/cms_039236.pdf) while the TaqPath ProAmp Master Mix can handle samples that may have inhibitors present.
There is a preamplification protocol included with our TaqMan Sample-to-SNP Kit. This is designed to work with a lysate sample.
We recommend using ~1-20 ng of good-quality gDNA per well. The gDNA should have an A260/A280 ratio of ~1.7-1.9. It is also important to try to add the same amount of gDNA to every well.
You can use our Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays) to submit your SNP sequence for an assay design. Alternatively, you can also use Primer Express Software to design an assay. The DNA sequence needs to have at least 30 bases on each side of the SNP site. The more sequence you provide, the greater chance you have of the tool creating a passing design. The ideal sequence length is ~ 200 bases on either side of the SNP site. For the best-performing assay, we recommend prescreening the sequence for other SNPs, repeats, and regions of low complexity. These variations should be masked prior to submitting the sequence. This will prevent the design tool from designing the primers or probe over those regions, which could reduce the efficiency of the assay if they were used. For more details on how to screen and mask the sequence, please follow the guidelines here (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf).
We recommend diluting the 40X and 80X TaqMan SNP Genotyping Assays to a 20X working stock with 1X TE buffer. The 1X TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and be made using DNase-free, sterile-filtered water.
The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.
A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).
A sample that clusters with the no template control may indicate that you did not add either DNA or an assay reagent to the reaction well. You may want to redo the experiment. A sample that clusters with the no template control may also indicate the presence of two null alleles in the individual. It is recommended that you repeat the experiment. If the sample again clusters with the no template control, you may want to run a gene dosage assay. All samples that did not amplify in the SNP assay may have a copy number of 0 in the gene dosage assay. Use a positive control to ensure everything else is working.
A cluster plot with more than three clusters may mean that there is an additional SNP under the TaqMan probe or there may be a copy number polymorphism. It is recommended that you perform the assay again to verify the extra cluster. If the extra cluster persists with the same samples, you may want to perform comparative sequencing on the outlier samples to identify if there are any other SNPs present. A persisting extra cluster may also indicate a copy number polymorphism. Homozygous individuals with extra copy numbers of the gene will generally cluster with the homozygous cluster. Only heterozygous individuals tend to fall into a 4 cluster that lies between the heterozygote cluster and one of the homozygous clusters. Therefore, since homozygous copy number variation is somewhat hidden, gene dosage assays should be performed on all samples to determine which individuals carry the extra copies of the gene.
The presence of a single cluster may indicate that the allele has a very low minor allele frequency (i.e., less than 5% is a rare allele). You should verify the minor allele frequency listed on our website. If there is an allele nomenclature associated with the assay, you may want to refer to the reference paper associated with the polymorphism to determine what population size is needed to see the minor allele. Please note that the minor allele may only occur in certain populations. Visit the article "Interpreting Scatterplots in Genotyping Experiments" in the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for more information.
In addition to using a no template control, we suggest that you use a positive control (sample with a known SNP genotype). This will help you assess the performance of an assay. Unfortunately, we do not offer positive controls for this product line. Visit the Genotyping section of the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for tips on how to obtain positive controls for genotyping experiments.
No, the TaqMan Drug Metabolism Assays thermocycling parameters are not optimized to run TaqMan Genotyping Assays. You should use the thermocycling parameters recommended for TaqMan Genotyping Assays.
We recommend two quantification methods: 1) Quantify genomic DNA using the TaqMan RNase P Reference Assay as outlined in the technical note, RNase P Quantification for Genotyping Experiments (https://tools.thermofisher.com/content/sfs/manuals/MAN0014349_RNase_P_Quantification_QR.pdf) or 2) quantifying the DNA using a reliable method such as a fluorometer like the Qubit, or UV/VIS spectrophotometry (A260/A280 measurement). Please refer to the TaqMan Drug Metabolism Assay Protocol (Cat. No. 4362038).
This is an indication of the version. An assay ID with an _30 would mean the third revision of that particular design (i.e. _10 was first version). For some of the DME assays, there is a capital letter with a number after it (i.e. _A0).
Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.
The final concentrations in the reaction mix are as follows:
If our custom assay design service was used and the user opted for the sequence information to be kept confidential, the sequence information is kept hidden.
Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.
The AIF includes Sales Order number, part number, assay ID, Plate ID, well location, vial ID, probe and primer
concentrations, and the Context Sequence. it also includes NCBI dbSNP ID, Celera ID, chromosome location, group ID, cytogenic location, gene association, SNP type, and Applied Biosystems minor allele frequencies, if applicable. Custom assays will have primer and probe sequences but not context sequence.
Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.
To reorder the same Custom TaqMan Assay, you can follow these steps:
- Select an appropriate catalog number, considering the size of the assay that you want. You can find the different catalog numbers for Custom TaqMan Assays on their respective product pages on thermofisher.com.
- Once you have identified the necessary catalog number, go to www.thermofisher.com and click on "Quick Order", in the top right corner of the screen.
- In the following page, paste your selected catalog number in the "Catalog Number" field and paste the assay ID from your previous order in the "Assay ID" field.
- Click "Add to cart" and then in the following screen click "Proceed to check out".
Each predesigned TaqMan SNP Genotyping Assay is delivered in a single tube consisting of two differentially labeled allele-specific TaqMan MGB (minor groove binding) probes and a pair of PCR primers. For more information, please see the following link: https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-applications/genetic-variation-analysis-using-real-time/snp-genotyping-with-real-time-pcr.html
Besides the TaqMan SNP Genotyping Assay, you would need to purchase a Genotyping Master Mix and nuclease-free water. A list of compatible master mixes can be found in the following link: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0009593_TaqManSNP_UG.pdf.
Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.
To download the sequences of a custom TaqMan assay, go to https://www.thermofisher.com/order/taqman-files and select “TaqMan Assays”. In the following screen, indicate the sales order number and the rack ID. Both numbers are in the box of the assay, near the barcode.
If you do not have these numbers, or if you need more information, please reach out to our technical support team at techsupport@thermofisher.com.
Find additional tips, troubleshooting help, and resources within our Labeling Chemistry Support Center.
If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software (https://www.thermofisher.com/qpcrsoftware). Another option is the Genotyping App on the Thermofisher Cloud (https://www.thermofisher.com/cloud). These programs have improved algorithms which allow them to make calls that are often missed by the instrument software. In addition, make sure you are running a sufficient number of samples (more than 3), and include at least one NTC well which is labeled in the software.
The software does not allow assay IDs or sample IDs to be modified. If a typo occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup -->Assays or Setup -->Samples.
Targets of interest that are not covered by the current Applied Biosystems TaqMan SNP Genotyping collection can be submitted to Custom TaqMan SNP Assay design.
The Custom TaqMan Assay Design Tool (CADT) is available on www.thermofisher.com. Order a custom TaqMan SNP Genotyping Assay by first entering a sequence with the SNP in brackets, for example [A/G], then submitting the chosen target sites for assay design. Upon notification of successful assay design by email, click the link in the message and add the desired custom assays to your shopping basket.
CADT can be used to design assays targeting biallelic SNPs or insertion/deletion polymorphisms and multi‐nucleotide polymorphisms (MNPs) that are 6 bases or fewer in length. This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM or VIC labels and MGB‐NFQ quenchers.
Note that sequences must be SNP and repeat‐masked before submission to CADT. Additionally, the genome‐uniqueness for assays must first be established, because custom assays are not compared to the genome (e.g., by BLAT or BLASTn) to determine target specificity. Any target on the “unavailable list” (described on page 25) should not be submitted to CADT, because an assay may be designed but it will fail to function properly. For targets that present assay design challenges, contact our fee‐for‐design custom assay design service at custom.solutions@thermofisher.com.
This is not recommended. For best sensitivity in discriminating between alleles in endpoint analysis, the target polymorphism sequence should appear within the differentially-labeled probes. In our pre-designed TaqMan Assays for SNP Genotyping, the single nucleotide polymorphism is generally located within the middle-third of the TaqMan probe sequence.
Applied Biosystems TaqMan MGB (minor groove binder) probes would be appropriate for Allelic Discrimination/SNP Genotyping probe designs. TaqMan MGB probes have a minor groove binder at the end of the probe. This minor groove binder increases the Tm of probes, allowing the use of shorter probes. Consequently, the TaqMan MGB probes exhibit greater differences in Tm values between matched and mismatched probes, which provides more accurate allele discrimination.
For information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to our guide "Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express".