TaqMan™ SNP Genotyping Assay, human, M (1000 reactions), made to order - FAQs

查看更多产品信息 TaqMan™ SNP Genotyping Assay, human - FAQs (4351379, 4351374, 4351376)

24 个常见问题解答

What is the maximum size of insertion/deletion that can be detected by a TaqMan SNP Genotyping Assay?

Assays can detect an insertion/deletion of up to 6 bases. If you desire an assay to detect a larger insertion or deletion you may want to consider our Custom Design Service (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/custom-services-reagents-real-time-pcr-qpcr/custom-services-real-time-pcr-assays.html).

What can I do if there are no predesigned assays to my SNP?

You can use our Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays) to submit your SNP sequence for an assay design. Alternatively, you can also use Primer Express Software to design an assay.

How do I find an assay to my SNP?

You can easily find predesigned TaqMan SNP Genotyping Assays with our user-friendly search tool at https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays.html. Simply search by:

-Target (assay ID, rs number, gene symbol)
-Specific location on a chromosome

You can also watch this short video (https://www.youtube.com/watch?feature=player_embedded&v=qA4VWe8Jyrs) on how to search for assays.

Can the TaqMan SNP Genotyping Assays be used for allele quantification?

No. TaqMan SNP assays contain competitive probe sequences with a 1 bp mismatch where the SNP is located. The other probe will still bind at a lower efficiency, producing some signal for the other fluorophore. Therefore, these are not quantitative.

In my TaqMan SNP Genotyping Assay, which base is labeled with FAM or VIC dye?

The probe labels are provided in the assay documentation and also online. Simply look up the assay by typing the assay ID into the search bar on thermofisher.com. Click on the “View Details” button, and under the Product Details look for the Context Sequence. The assays are always in a [VIC/FAM dye] order. From the context sequence, you can see which base is first (thus labeled with VIC dye), and which is second (thus labeled with FAM dye).

What does the context sequence in the AIF for TaqMan Drug Metabolism Genotyping Assays indicate?

The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.

What do all of the columns mean in the Assay Index File (AIF) that comes with each TaqMan Drug Metabolism Assay?

A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).

My TaqMan Drug Metabolism Genotyping Assay shows some samples clustering with the no template controls. What does this mean?

A sample that clusters with the no template control may indicate that you did not add either DNA or an assay reagent to the reaction well. You may want to redo the experiment. A sample that clusters with the no template control may also indicate the presence of two null alleles in the individual. It is recommended that you repeat the experiment. If the sample again clusters with the no template control, you may want to run a gene dosage assay. All samples that did not amplify in the SNP assay may have a copy number of 0 in the gene dosage assay. Use a positive control to ensure everything else is working.

My TaqMan Drug Metabolism Genotyping Assay cluster plot shows more than three clusters (outliers).  What does this mean?

A cluster plot with more than three clusters may mean that there is an additional SNP under the TaqMan probe or there may be a copy number polymorphism. It is recommended that you perform the assay again to verify the extra cluster. If the extra cluster persists with the same samples, you may want to perform comparative sequencing on the outlier samples to identify if there are any other SNPs present. A persisting extra cluster may also indicate a copy number polymorphism. Homozygous individuals with extra copy numbers of the gene will generally cluster with the homozygous cluster. Only heterozygous individuals tend to fall into a 4 cluster that lies between the heterozygote cluster and one of the homozygous clusters. Therefore, since homozygous copy number variation is somewhat hidden, gene dosage assays should be performed on all samples to determine which individuals carry the extra copies of the gene.

My TaqMan Drug Metabolism Genotyping Assay shows only one cluster. What does this mean?

The presence of a single cluster may indicate that the allele has a very low minor allele frequency (i.e., less than 5% is a rare allele). You should verify the minor allele frequency listed on our website. If there is an allele nomenclature associated with the assay, you may want to refer to the reference paper associated with the polymorphism to determine what population size is needed to see the minor allele. Please note that the minor allele may only occur in certain populations. Visit the article "Interpreting Scatterplots in Genotyping Experiments" in the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for more information.

What controls do you recommend running with a TaqMan Drug Metabolism Genotyping Assay?

In addition to using a no template control, we suggest that you use a positive control (sample with a known SNP genotype). This will help you assess the performance of an assay. Unfortunately, we do not offer positive controls for this product line. Visit the Genotyping section of the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for tips on how to obtain positive controls for genotyping experiments.

Can I run all of the TaqMan SNP Genotyping Assays using the TaqMan Drug Metabolism Assay thermocycling protocol?

No, the TaqMan Drug Metabolism Assays thermocycling parameters are not optimized to run TaqMan Genotyping Assays. You should use the thermocycling parameters recommended for TaqMan Genotyping Assays.

What do the different numbers after the underscore, at the end of a TaqMan SNP assay ID, mean?

This is an indication of the version. An assay ID with an _30 would mean the third revision of that particular design (i.e. _10 was first version). For some of the DME assays, there is a capital letter with a number after it (i.e. _A0).

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

What is the final concentration of probes and primers of a TaqMan SNP assay (Cat. No. 4351379, 4351376, 4351374, 4331349, 4332072, 4332073) in the reaction mix?

The final concentrations in the reaction mix are as follows:

  • Probes: 200 nM
  • Primer: 900 nM


Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

For TaqMan SNP Genotyping Assays (Cat. No. 4351379, 4351376, 4351374, 4331349, 4332072, 4332073), what information is contained in the Assay Information File (AIF)?

The AIF includes Sales Order number, part number, assay ID, Plate ID, well location, vial ID, probe and primer concentrations, and the Context Sequence. it also includes NCBI dbSNP ID, Celera ID, chromosome location, group ID, cytogenic location, gene association, SNP type, and Applied Biosystems minor allele frequencies, if applicable. Custom assays will have primer and probe sequences but not context sequence.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

What are the sequences for the TaqMan primers and probes in the TaqMan SNP Genotyping Assay (Cat. Nos. 4351374, 4351376, 4351379)?

The sequences for probes and primers of our predesigned TaqMan assays are proprietary. If you need the sequence to publish the results obtained with TaqMan assays, you can find more information about publishing results using the following links below:

Primer Sequence Disclosure: A Clarification of the MIQE Guidelines

Publish Real-Time PCR Results with Confidence

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

Are the TaqMan SNP assays still being offered as "Functionally Tested" and "Validated and Functionally Tested" assays?

Yes. Each TaqMan SNP Genotyping Assay is functionally tested for match to respective mixed ethnic populations. Within each category of the assay list, validated assays are tested across 45 individuals for each population to meet stringent performance criteria, including minor allele frequencies from various sources such as Hapmap, JSNP, NCBI, and/or AGI (Applera Genome Initiative) for additional information. In comparison, functionally tested assays are tested against a mixed ethnic population, consisting of approximately 10-20 individuals, but these may not have results for some minor allele frequencies due to the small and mixed sample set used in the test. This applies to the Custom TaqMan SNP Genotyping Assays for humans, but not for nonhuman SNP assays.

I would like to order a TaqMan SNP Genotyping Assay. Does the kit include everything I need to perform my experiment or do I need to purchase reagents separately?

Each predesigned TaqMan SNP Genotyping Assay is delivered in a single tube consisting of two differentially labeled allele-specific TaqMan MGB (minor groove binding) probes and a pair of PCR primers. For more information, please see the following link: https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-applications/genetic-variation-analysis-using-real-time/snp-genotyping-with-real-time-pcr.html

Besides the TaqMan SNP Genotyping Assay, you would need to purchase a Genotyping Master Mix and nuclease-free water. A list of compatible master mixes can be found in the following link: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0009593_TaqManSNP_UG.pdf.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

What fluorophores are the probes within the TaqMan SNP Genotyping Assay, human (Cat. No. 4351379) labeled with?

The probes within the TaqMan SNP Genotyping Assay, human (Cat. No. 4351379) are labeled with VIC dye and FAM dye (please see also page 11 of the User Guide here: https://tools.thermofisher.com/content/sfs/manuals/TaqMan_SNP_Genotyping_Assays_man.pdf

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

What are the storage conditions for the TaqMan and Custom TaqMan Gene Expression and SNP Genotyping Assays?

After shipment, the assay mixes should be stored at -15 C to -20 C to maximize stability. Freeze/thaws should be kept to a minimum (a maximum of 10 freeze-thaw cycles is recommended). Keep all TaqMan and Custom TaqMan Gene Expression and SNP Genotyping Assays protected from direct exposure to light. Excessive exposure to light may affect the fluorescent probes. If desired, the Assay Mix may be diluted with TE buffer or DNase-free Water. It is recommended to make working stocks from the stock solutions provided in these kits.

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

Why is the auto calling in the instrument software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software (https://www.thermofisher.com/qpcrsoftware). Another option is the Genotyping App on the Thermofisher Cloud (https://www.thermofisher.com/cloud). These programs have improved algorithms which allow them to make calls that are often missed by the instrument software. In addition, make sure you are running a sufficient number of samples (more than 3), and include at least one NTC well which is labeled in the software.

I have imported experiment files into my study, can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typo occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup -->Assays or Setup -->Samples. 

I cannot find a pre-designed assay to my target. Do you have a custom option?

Targets of interest that are not covered by the current Applied Biosystems TaqMan SNP Genotyping collection can be submitted to Custom TaqMan SNP Assay design. 

The Custom TaqMan Assay Design Tool (CADT) is available on www.thermofisher.com. Order a custom TaqMan SNP Genotyping Assay by first entering a sequence with the SNP in brackets, for example [A/G], then submitting the chosen target sites for assay design. Upon notification of successful assay design by email, click the link in the message and add the desired custom assays to your shopping basket. 

CADT can be used to design assays targeting biallelic SNPs or insertion/deletion polymorphisms and multi‐nucleotide polymorphisms (MNPs) that are 6 bases or fewer in length. This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM or VIC labels and MGB‐NFQ quenchers. 

Note that sequences must be SNP and repeat‐masked before submission to CADT. Additionally, the genome‐uniqueness for assays must first be established, because custom assays are not compared to the genome (e.g., by BLAT or BLASTn) to determine target specificity. Any target on the “unavailable list” (described on page 25) should not be submitted to CADT, because an assay may be designed but it will fail to function properly. For targets that present assay design challenges, contact our fee‐for‐design custom assay design service at custom.solutions@thermofisher.com.

When designing probes to perform Allelic Discrimination (SNP assays), are there any alternatives to using probes longer than 30bp in order to get the appropriate melting temperature?

Applied Biosystems TaqMan MGB (minor groove binder) probes would be appropriate for Allelic Discrimination/SNP Genotyping probe designs. TaqMan MGB probes have a minor groove binder at the end of the probe. This minor groove binder increases the Tm of probes, allowing the use of shorter probes. Consequently, the TaqMan MGB probes exhibit greater differences in Tm values between matched and mismatched probes, which provides more accurate allele discrimination.

For information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to our guide "Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express".