TaqMan™ SNP Genotyping Assay, human, S (300 reactions), made to order - FAQs

查看更多产品信息 TaqMan™ SNP Genotyping Assay, human - FAQs (4351379, 4351374, 4351376)

46 个常见问题解答

How do I set up a reference panel in the TaqMan Genotyper Software?

A reference panel is helpful in large studies to mark your reference samples. Please follow the directions here on how to set up a reference panel.

How do I enter the polymorphism sequence information (i.e., A, C, G, T) for my assays, and where is this info displayed in the TaqMan Genotyper Software?

The polymorphism sequence info can be entered into the software through Setup >Assays. You can import an assay information file (AIF) that contains this info for your assays (AIFs are shipped with assay orders), or manually enter this info for each assay using the edit assay feature. The polymorphism sequence info will be displayed in the assays table under allele1 base and allele2 base, in the results table in the calls column, in the cluster plot display in the x-axis and y-axis titles, and in the export files as genotypes. If no sequence information is entered for an assay, the default display for genotype calls will use the dye names, such as VIC/VIC, VIC/FAM or FAM/FAM dyes.

What is the bookmarking feature in the TaqMan Genotyper Software, and how would I use it?

Bookmarking is a unique feature in TaqMan Genotyper Software that allows you to tag a data point or well while reviewing results in a Study. For example, in reviewing a cluster plot for an assay, a data point is observed to be somewhat between clusters. You can set a bookmark for this data point to denote this well for further investigation. The bookmark persists between the Results workspace and Quality Control workspace, so you can easily identify the data point in a cluster plot, experiment plate view, or on the samples tab. Bookmarks are cleared upon exit from a Study or exit from the application.

I am getting the message: "An error has occurred. See the log file C:\ProgramFiles\Applied Biosystems\TaqMan Genotyper\config\eclipse\1363113099385.log." How can I fix this?

1.Go to the Start button, then Programs, then TaqMan Genotyper Software
2.Right-click on the program and choose “Run as Administrator”
3.If that does not work, go back to the same menu and choose “Properties”
4.Choose the “Compatibility” tab, and check “Run this program as administrator”
5.Click “Apply”
6.You may+C69 have to restart the computer for the settings to apply

Can I delete an assay or sample from my qPCR study?

An assay or sample may be deleted from a study only if there is no data or wells associated with it. Upon import of an experiment, the software collects all the assays and samples from the plate and lists them in the Setup > Assays or Setup > Samples workspaces. The assays and samples are stored in these workspaces as a library, and remain there even if you delete the experiment from the Study. Deleting the experiment will remove any data (wells) associated with the assays or samples, but not the assays or samples from the library. The assays and samples must then be deleted from these workspaces to remove them from the Study.

I have imported experiment files into my study. Can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typing error occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup --> Assays or Setup --> Samples.

I have trailing clusters in my allelic discrimination plot. What can I do to improve the clustering?

Trailing clusters are often due to variation in gDNA quality or concentration. Please see the example here for more details (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/trailing-clusters.html).

I'm getting more than 3 clusters with my qPCR assay. What is wrong?

Multiple clusters such as in the example below could be due to a hidden SNP under the probe or primer. Search dbSNP (https://www.ncbi.nlm.nih.gov/SNP/) for other SNPs around the target SNP. If the nontarget SNP has a low MAF it will usually not be a problem. If the nontarget SNP is under a primer, try to redesign and mask it as an “N”. Another possibility is that the region is within a copy number variation, in which case you will have to evaluate with a TaqMan Copy Number Assay as well.

I'm only getting a single cluster after qPCR. Why is that?

Check the Minor Allele Frequency (MAF) of the SNP. You may need a larger sample size in order to see the allele. You can use the Hardy-Weinberg equation to determine if the minor allele is detectable in your sample size or not. Follow the example here (p. 4-2).

My clusters are too close together when performing qPCR. What can I do?

Depending on the assay, you may want to try either reducing or increasing the number of cycles. Our newer instrument software can even allow you to view the traces if you collect the real-time data on the instrument.

Why is the autocalling in the software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software. This program has an improved algorithm which allows it to make calls that are often missed by the SDS software.

My SNP assay is not amplifying. What is wrong?

There are several reasons for a SNP assay not amplifying, including:

-DNA may not be accurately quantitated
-Degraded DNA
-Inhibitors in the sample
-Error in reaction setup

Check out our troubleshooting tool for more details at https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/qpcr-education/real-time-pcr-troubleshooting-tool/snp-genotyping-troubleshooting/snp-not-amplifying.html.

My custom SNP assay failed and my order was canceled. Why did it fail, and what can I do?

This could happen if the assay fails functional testing. All human SNP genotyping assays get tested with a panel of human gDNA samples. The assay must show amplification with at least one cluster in order to pass. When there is no amplification you will be notified of the failure and not charged for the assay. The assay may have failed for the following reasons:

-Input sequence was incorrect (cDNA instead of gDNA)
-Input sequence was not human
-Input sequence was not appropriately pre-screened
-Signal from NTC was less than 0.5 units from samples (assay did not give high fluorescence signal)

To resolve this, please consult the guidelines in the Design and Ordering Guide (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf) to properly prepare the sequence for the Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays). If the sequence was not human, make sure to select non-human at the species filter step. Nonhuman assays do not get functionally tested.

Can I analyze a triallelic SNP?

Yes, you can analyze a triallelic SNP using paired TaqMan SNP Genotyping Assays. Please refer to this application note for more information (https://tools.thermofisher.com/content/sfs/brochures/cms_055168.pdf).

How do I find positive control samples for my TaqMan SNP Genotyping Assays?

We do not provide control samples. However, Coriell has a large gDNA repository and you may be able to find controls there. Go to: http://ccr.coriell.org/ and choose “SNP Search”. Enter your rs number or gene name. If there are samples available you will see them in the table, such as in this example below. Browse the different genotypes for your desired controls. If a control is not available, you can have one synthesized using GeneArt Gene Synthesis.

What master mix can I use with the TaqMan SNP Genotyping Assays?

We recommend using either the TaqPath ProAmp Master Mix or the TaqMan Genotyping Master Mix. The TaqMan Genotyping Master Mix has the advantage of proven performance with up to 3 days of pre- and post-PCR stability, allowing you to set up plates ahead of time or read the plates later (see the data here, https://tools.thermofisher.com/content/sfs/brochures/cms_039236.pdf) while the TaqPath ProAmp Master Mix can handle samples that may have inhibitors present.

Can I use preamplification with the TaqMan SNP Genotyping Assays?

There is a preamplification protocol included with our TaqMan Sample-to-SNP Kit. This is designed to work with a lysate sample.

How much gDNA should I use with my TaqMan SNP Genotyping Assay?

We recommend using ~1-20 ng of good-quality gDNA per well. The gDNA should have an A260/A280 ratio of ~1.7-1.9. It is also important to try to add the same amount of gDNA to every well.

How should I dilute the TaqMan SNP Genotyping Assays?

We recommend diluting the 40X and 80X TaqMan SNP Genotyping Assays to a 20X working stock with 1X TE buffer. The 1X TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and be made using DNase-free, sterile-filtered water.

What is the maximum size of insertion/deletion that can be detected by a TaqMan SNP Genotyping Assay?

Assays can detect an insertion/deletion of up to 6 bases. If you desire an assay to detect a larger insertion or deletion you may want to consider our Custom Design Service (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/custom-services-reagents-real-time-pcr-qpcr/custom-services-real-time-pcr-assays.html).

What can I do if there are no predesigned assays to my SNP?

You can use our Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays) to submit your SNP sequence for an assay design. Alternatively, you can also use Primer Express Software to design an assay.

How do I find an assay to my SNP?

You can easily find predesigned TaqMan SNP Genotyping Assays with our user-friendly search tool at https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays.html. Simply search by:

-Target (assay ID, rs number, gene symbol)
-Specific location on a chromosome

You can also watch this short video (https://www.youtube.com/watch?feature=player_embedded&v=qA4VWe8Jyrs) on how to search for assays.

Can the TaqMan SNP Genotyping Assays be used for allele quantification?

No. TaqMan SNP assays contain competitive probe sequences with a 1 bp mismatch where the SNP is located. The other probe will still bind at a lower efficiency, producing some signal for the other fluorophore. Therefore, these are not quantitative.

In my TaqMan SNP Genotyping Assay, which base is labeled with FAM or VIC dye?

The probe labels are provided in the assay documentation and also online. Simply look up the assay by typing the assay ID into the search bar on thermofisher.com. Click on the “View Details” button, and under the Product Details look for the Context Sequence. The assays are always in a [VIC/FAM dye] order. From the context sequence, you can see which base is first (thus labeled with VIC dye), and which is second (thus labeled with FAM dye).

What is the relationship between LD (linkage disequilibrium) blocks and LDU (linkage disequilibrium units)?

LD blocks are better known as "haplotype blocks". These are chromosome segments where SNP alleles show strong linkage disequilibrium among themselves, and there is little evidence of recombination. These regions appear to be inherited together within a population, and thus are characterized by low haplotype diversity. LDU represents the decay of linkage disequilibrium between two SNPs, therefore the greater the haplotype diversity between two markers, the greater the LDU.

Can I use TaqMan 2X Universal PCR Master Mix (including AmpErase UNG with TaqMan MicroRNA Assays?

TaqMan MicroRNA Assays protocol (Cat. No. 4364031) recommends TaqMan 2X Universal PCR Master Mix, No AmpErase UNG (Cat. No. 4324018). However, all TaqMan MicroRNA Assays can be used with TaqMan 2X Universal PCR Master Mix, with AmpErase UNG (Cat. No. 4304437).

Which type of probes are preferred for allelic discrimination (AD) assays: TAMRAor MGB probes?

Both MGB and TAMRA probes can be used, but for AD assays MGB probes have some advantages. MGB probes have a minor groove-binder moiety on the 3' end, which enhances Tm. Therefore MGB probes have higher Tms for the exact same sequence as compared to a standard TaqMan TAMRA probe.

This Tm difference is advantageous for AD assays. The shorter the probe is, the greater the Tm differential between matched and mismatched probes. There may be many other applications that a smaller probe can be used for (for example, designing a probe over a small conserved region of sequence). The overall fluorescence in the reaction is decreased, as well, because the MGB moiety is nonfluorescent, which may help with the discrimination.

For more information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to the tutorial “Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express Software” (Cat. No. 4370991). You can find a copy on our website by entering this title or the Catalog No. as keywords in the main Search field.

What does the context sequence in the AIF for TaqMan Drug Metabolism Genotyping Assays indicate?

The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.

What do all of the columns mean in the Assay Index File (AIF) that comes with each TaqMan Drug Metabolism Assay?

A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).

My TaqMan Drug Metabolism Genotyping Assay shows some samples clustering with the no template controls. What does this mean?

A sample that clusters with the no template control may indicate that you did not add either DNA or an assay reagent to the reaction well. You may want to redo the experiment. A sample that clusters with the no template control may also indicate the presence of two null alleles in the individual. It is recommended that you repeat the experiment. If the sample again clusters with the no template control, you may want to run a gene dosage assay. All samples that did not amplify in the SNP assay may have a copy number of 0 in the gene dosage assay. Use a positive control to ensure everything else is working.

My TaqMan Drug Metabolism Genotyping Assay cluster plot shows more than three clusters (outliers).  What does this mean?

A cluster plot with more than three clusters may mean that there is an additional SNP under the TaqMan probe or there may be a copy number polymorphism. It is recommended that you perform the assay again to verify the extra cluster. If the extra cluster persists with the same samples, you may want to perform comparative sequencing on the outlier samples to identify if there are any other SNPs present. A persisting extra cluster may also indicate a copy number polymorphism. Homozygous individuals with extra copy numbers of the gene will generally cluster with the homozygous cluster. Only heterozygous individuals tend to fall into a 4 cluster that lies between the heterozygote cluster and one of the homozygous clusters. Therefore, since homozygous copy number variation is somewhat hidden, gene dosage assays should be performed on all samples to determine which individuals carry the extra copies of the gene.

My TaqMan Drug Metabolism Genotyping Assay shows only one cluster. What does this mean?

The presence of a single cluster may indicate that the allele has a very low minor allele frequency (i.e., less than 5% is a rare allele). You should verify the minor allele frequency listed on our website. If there is an allele nomenclature associated with the assay, you may want to refer to the reference paper associated with the polymorphism to determine what population size is needed to see the minor allele. Please note that the minor allele may only occur in certain populations. Visit the article "Interpreting Scatterplots in Genotyping Experiments" in the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for more information.

What controls do you recommend running with a TaqMan Drug Metabolism Genotyping Assay?

In addition to using a no template control, we suggest that you use a positive control (sample with a known SNP genotype). This will help you assess the performance of an assay. Unfortunately, we do not offer positive controls for this product line. Visit the Genotyping section of the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for tips on how to obtain positive controls for genotyping experiments.

Can I run all of the TaqMan SNP Genotyping Assays using the TaqMan Drug Metabolism Assay thermocycling protocol?

No, the TaqMan Drug Metabolism Assays thermocycling parameters are not optimized to run TaqMan Genotyping Assays. You should use the thermocycling parameters recommended for TaqMan Genotyping Assays.

What is the final concentration of probes and primers of a TaqMan SNP assay (Cat. No. 4351379, 4351376, 4351374, 4331349, 4332072, 4332073) in the reaction mix?

The final concentrations in the reaction mix are as follows:

  • Probes: 200 nM
  • Primer: 900 nM


Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

For TaqMan SNP Genotyping Assays (Cat. No. 4351379, 4351376, 4351374, 4331349, 4332072, 4332073), what information is contained in the Assay Information File (AIF)?

The AIF includes Sales Order number, part number, assay ID, Plate ID, well location, vial ID, probe and primer concentrations, and the Context Sequence. it also includes NCBI dbSNP ID, Celera ID, chromosome location, group ID, cytogenic location, gene association, SNP type, and Applied Biosystems minor allele frequencies, if applicable. Custom assays will have primer and probe sequences but not context sequence.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

What are the sequences for the TaqMan primers and probes in the TaqMan SNP Genotyping Assay (Cat. Nos. 4351374, 4351376, 4351379)?

The sequences for probes and primers of our predesigned TaqMan assays are proprietary. If you need the sequence to publish the results obtained with TaqMan assays, you can find more information about publishing results using the following links below:

Primer Sequence Disclosure: A Clarification of the MIQE Guidelines

Publish Real-Time PCR Results with Confidence

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

Are the TaqMan SNP assays still being offered as "Functionally Tested" and "Validated and Functionally Tested" assays?

Yes. Each TaqMan SNP Genotyping Assay is functionally tested for match to respective mixed ethnic populations. Within each category of the assay list, validated assays are tested across 45 individuals for each population to meet stringent performance criteria, including minor allele frequencies from various sources such as Hapmap, JSNP, NCBI, and/or AGI (Applera Genome Initiative) for additional information. In comparison, functionally tested assays are tested against a mixed ethnic population, consisting of approximately 10-20 individuals, but these may not have results for some minor allele frequencies due to the small and mixed sample set used in the test. This applies to the Custom TaqMan SNP Genotyping Assays for humans, but not for nonhuman SNP assays.

I would like to order a TaqMan SNP Genotyping Assay. Does the kit include everything I need to perform my experiment or do I need to purchase reagents separately?

Each predesigned TaqMan SNP Genotyping Assay is delivered in a single tube consisting of two differentially labeled allele-specific TaqMan MGB (minor groove binding) probes and a pair of PCR primers. For more information, please see the following link: https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-applications/genetic-variation-analysis-using-real-time/snp-genotyping-with-real-time-pcr.html

Besides the TaqMan SNP Genotyping Assay, you would need to purchase a Genotyping Master Mix and nuclease-free water. A list of compatible master mixes can be found in the following link: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0009593_TaqManSNP_UG.pdf.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

What fluorophores are the probes within the TaqMan SNP Genotyping Assay, human (Cat. No. 4351379) labeled with?

The probes within the TaqMan SNP Genotyping Assay, human (Cat. No. 4351379) are labeled with VIC dye and FAM dye (please see also page 11 of the User Guide here: https://tools.thermofisher.com/content/sfs/manuals/TaqMan_SNP_Genotyping_Assays_man.pdf

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

What are the storage conditions for the TaqMan and Custom TaqMan Gene Expression and SNP Genotyping Assays?

After shipment, the assay mixes should be stored at -15 C to -20 C to maximize stability. Freeze/thaws should be kept to a minimum (a maximum of 10 freeze-thaw cycles is recommended). Keep all TaqMan and Custom TaqMan Gene Expression and SNP Genotyping Assays protected from direct exposure to light. Excessive exposure to light may affect the fluorescent probes. If desired, the Assay Mix may be diluted with TE buffer or DNase-free Water. It is recommended to make working stocks from the stock solutions provided in these kits.

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

What is the key to running Allelic Discrimination and SNP assays, i.e. what makes it possible to discriminate something as small as a single base difference?

The key to Allelic Discrimination is the Tm difference between the perfectly matched and the mismatched probe and their respective binding affinities for the same sequence. There will be a Tm window in which the matched probe will be more likely than the mismatched probe to bind and be cleaved by the 5'-nuclease activity of the AmpliTaq Gold DNA polymerase. The competition for binding between these two probes favors the binding and cleavage of the matched probe, and use of TaqMan MGB probes make clean discrimination more likely. For additional information on TaqMan MGB probes and their use and design, please refer to User Bulletin “Primer Express v1.5 and TaqMan MGB Probes for Allelic Discrimination: All PCR Instruments”. Simply search for the title on our website to find a copy.

Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.

Why is the auto calling in the instrument software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software (https://www.thermofisher.com/qpcrsoftware). Another option is the Genotyping App on the Thermofisher Cloud (https://www.thermofisher.com/cloud). These programs have improved algorithms which allow them to make calls that are often missed by the instrument software. In addition, make sure you are running a sufficient number of samples (more than 3), and include at least one NTC well which is labeled in the software.

I have imported experiment files into my study, can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typo occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup -->Assays or Setup -->Samples. 

I cannot find a pre-designed assay to my target. Do you have a custom option?

Targets of interest that are not covered by the current Applied Biosystems TaqMan SNP Genotyping collection can be submitted to Custom TaqMan SNP Assay design. 

The Custom TaqMan Assay Design Tool (CADT) is available on www.thermofisher.com. Order a custom TaqMan SNP Genotyping Assay by first entering a sequence with the SNP in brackets, for example [A/G], then submitting the chosen target sites for assay design. Upon notification of successful assay design by email, click the link in the message and add the desired custom assays to your shopping basket. 

CADT can be used to design assays targeting biallelic SNPs or insertion/deletion polymorphisms and multi‐nucleotide polymorphisms (MNPs) that are 6 bases or fewer in length. This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM or VIC labels and MGB‐NFQ quenchers. 

Note that sequences must be SNP and repeat‐masked before submission to CADT. Additionally, the genome‐uniqueness for assays must first be established, because custom assays are not compared to the genome (e.g., by BLAT or BLASTn) to determine target specificity. Any target on the “unavailable list” (described on page 25) should not be submitted to CADT, because an assay may be designed but it will fail to function properly. For targets that present assay design challenges, contact our fee‐for‐design custom assay design service at custom.solutions@thermofisher.com.

When designing probes to perform Allelic Discrimination (SNP assays), are there any alternatives to using probes longer than 30bp in order to get the appropriate melting temperature?

Applied Biosystems TaqMan MGB (minor groove binder) probes would be appropriate for Allelic Discrimination/SNP Genotyping probe designs. TaqMan MGB probes have a minor groove binder at the end of the probe. This minor groove binder increases the Tm of probes, allowing the use of shorter probes. Consequently, the TaqMan MGB probes exhibit greater differences in Tm values between matched and mismatched probes, which provides more accurate allele discrimination.

For information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to our guide "Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express".