TaqMan™ Copy Number Reference Assay, mouse, Tert, 750 reactions - FAQs

查看更多产品信息 TaqMan™ Copy Number Reference Assay, mouse, Tert - FAQs (4458369, 4458368)

25 个常见问题解答

Can I use TaqMan Gene Expression Assays for a gene copy number study?

TaqMan Gene Expression Assays with “_s1” as assay ID suffix are the assays whose primers and probes are designed within a single exon, and therefore, will detect genomic DNA. However, the application of these assays in gene copy number studies has not been validated. Other gene expression assays will not detect gDNA, let alone the region of variance.

What type of samples should be run with TaqMan Copy Number Assays?

These assays target regions of variance that are found in genomic DNA.

Do I need to do a validation test before I use the ΔΔCt method to determine the copy number of the target gene?

If you are using our copy number assays and reference assays, this is not necessary.

Where can I get reference samples for TaqMan Copy Number Assays?

We recommend that you check the DGV (database of genomic variants) database for your CNV of interest. Not all regions of variance have control samples available, but if there are controls for your CNV, the DGV will list some Coriell sample ids. You can then order these control samples from Coriell.

What endogenous control is recommended for TaqMan Copy Number Assays?

We recommend that you run one of our TaqMan Copy Number Reference assays in duplex with your target copy number assay. In human, we offer Rnase P and TERT copy number reference assays; in mouse, we offer Tfrc and TERT copy number reference assays. The reference assays are VIC-TAMRA labeled so that they can be run in duplex with your target copy number assay of interest.

What TaqMan Copy Number Assays are available now?

We have predesigned TaqMan Copy number assays for human and mouse, and we also have the Geneassist Copy number assay workflow builder tool that you may use to submit sequences for custom designed assays. Copy number variation experiments require a reference assay run in duplex with the target assay. We offer RNase P and TERT reference assays for human, and we offer Tfrc and TERT reference assays for mouse. The copy number assays are FAM-MGB labeled and the copy number reference assays are VIC-TAMRA labeled.

Do you have a recommendation for a mouse reference gene for Copy Number Variation (CNV) analysis?

Yes, we do. We have two mouse reference assays targeting Tfrc and Tert:

  • TaqMan Copy Number Reference Assay, mouse, Tfrc (Cat. No. 4458366 and 4458367).
  • TaqMan Copy Number Reference Assay, mouse, Tert (Cat No. 4458368 and 4458369).


Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.

What is the concentration and sequence for my TaqMan Copy Number Reference Assay?

The TaqMan Copy Number Reference Assays have a concentration of 20x. Each reference assay contains a probe at 5 µM and primers at 18 µM concentration. The sequence is proprietary. However, the sequence for the padded amplicon is the following:

  • CN reference assay human RNase P (Cat. No. 4403326, 4403328) control amplicon: GTTCTGTATGAGACCACTTTTTCCCATAGGGCGGAGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTGTCACTCCACTCCCATGTCCCTTGGGAAGGTCTGAGACTAGGGCCAGAGGCGGCCCTAACAGGGCTCTCCCTGAGC
  • CN reference assay human TERT (Cat. No. 4403316, 4403315) control amplicon: GTATTTTACTCCCACAGCACCTCCCCCCAATTTGACCCACAGGGACCCCCATCCAGGTGCAGGGTCCTCGCCTGTGTACAGGGCACACCTTTGGTCACTCCAAATTCCCAGAGCTCCCAGGGTCCTTCTCAGGGTCTCCACCTGGATGGT
  • Mouse Tfrc ref (Cat. No. 4458366, 4458367) control sequence (padded amplicon): GATACCTATGAGGCATTGACTCAGAAAGTTCCTCAGCTCAACCAAATGGTTCGTACAGCAGCGGAAGTGGCTGGTCAGCTCATTATTAAACTTACCCATGACGTTGAATTGAACCTGGACTATGAGATGTATAACAGCAAACTACTGTCA
  • Mouse Tert ref (Cat. No. 4458368, 4458369) control sequence (padded amplicon): CAAATGTGAGGGGTGCCTGGGTGACCTCCTTGTCCTGACCATCTGGTGACACCCACCCCTGCCAGCACCTGCGTGTCTGCACCTGCATGTATGTTTGGTTCCATTGTGTTCTCTGAGAAGGCACTCACTTTTTTCACACGGCTGTCACCA


Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.

Why do the values for the reference assay dye (VIC dye) vary for my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
-The reference sequence is not present or contains polymorphisms in the gDNA sample. Use an alternate copy number reference assay.
- There is variability in the amount of gDNA sample added to each reaction. Quantify the gDNA, then adjust the concentration of gDNA as needed.
Note: In general, the calculation of sample-level ΔCt accounts for variability in sample concentration.
- Pipetting was inaccurate. Check the pipette calibration of the pipettes, and pipette at least 5 µL of sample to prepare the reaction mix.

Why is the multicomponent signal for ROX dye not flat for my TaqMan Copy Number Assay?

Most likely incorrect dyes were selected for each target. Check the dyes selected for each target, then reanalyze the data.

Why was there a simultaneous increase in fluorescence from both the passive reference dye (ROX dye) and the reporter dyes for my TaqMan Copy Number Assay?

Most likely the sample evaporated. We recommend that you check the seal of the adhesive film for leaks before running the plate on the real-time PCR instrument.

Why was there a decrease in ROX dye fluorescence (passive reference dye) in my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- There was insufficient Master Mix added to the reaction. Please follow accurate pipetting practices.
- Reagents are degraded. Ensure that the kits and reagents have been stored according to the instructions on the packaging and that they have not expired.

Why is there is a noisy signal above the threshold for my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
-The sample evaporated. Check the seal of the adhesive film for leaks.
- The well is empty because of inaccurate pipetting. Check the calibration of the pipettes, and pipette at least 5 µL of sample.
- The well is assigned a sample or target in the plate document or experiment, but the well is empty. Ensure that the plate document or experiment is set up correctly. Then try excluding the well and reanalyzing the data.

Why are the results for my TaqMan Copy Number Assay inconsistent (high standard deviation in the replicates, inconsistent data, or a variable Ct)?

Please review the following possible causes and solutions:
- The reagents were not mixed properly. Increase the length of time that you mix the reagents. We recommend that you confirm your mixing process by running a replicate assay.
- Pipetting was inaccurate. We recommend that you check the pipette calibration, and pipet at least 5 µL of sample to prepare the reaction mix.
- The threshold was not set correctly. Set the threshold above the noise level and where the replicates are tightest. See your real‑time PCR system user documentation for more information about setting the threshold.
-The concentration of one or more reaction components was incorrect. Ensure that the correct amounts of all the reactions components were added to the reaction plate.
- There was a low concentration of the target of interest. Rerun the assay with more gDNA template.
- Too much gDNA was added. We recommend that you reduce the amound of gDNA template added to the reaction mixture.
- The gDNA template or the amplicon is contaminated. Re-extract the gDNA and repeat the assay. Follow established PCR good laboratory practices to prevent contamination.

Why is there amplification in the negative control well for my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The reagents are contaminated with gDNA, amplicon or plasimd clones. We recommend that you esnure that your workspacea dn equpiment are cleaned correctly, then rerun the assay using new reagents. We also rsuggest that you use a Master Mix that contains UNG, such as TaqPath ProAmp Master Mix.
- The template or amplicon is contaminated. Please follow established PCR good laboratory practices to prevent contamination.

Why does the amplification curve show no amplification of the sample (Ct=40) in the target TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The copy number sequence is not present in the sample. First, run a sample with a known copy number for the target genomic region. Ensure that the Ct values for the reference assay (VIC dye) are normal in the samples without the copy number assay (FAM dye) signal. You can confirm your results by rerunning the sample using the same assay and/or running the sample using an alternative assay in the same genomic region, if available.

- There is a mismatch between the assay and the target sequence. We recommend that you perform bioinformatics for custom assays.
For example, ensure that the sequence submitted to assay design contains the correct target sequence. If needed, select an alternative target region for assay design or select another assay from the same genomic region. We also recommend using Custom Plus assays, which include bioinformatics.

- One or more of the PCR reaction components was not added. Check your pipetting equipment and/or technique.

- Incorrect dyes were selected for each target. Check the dyes selected for each target, then reanalyze the data.

- The annealing temperature was too high for the primers and/or probes. Ensure that the thermal cycler is set to the correct annealing and extension temperatures.
- The template is degraded. Determine the quality of the template, then rerun the assay with a fresh template if needed. We recommend that you use nuclease-free water.

- Inhibitors are present in the reaction. To check for inhibitors, we recommend that you run a serial dilution of your sample with an assay known to detect a tarfet in the sample (e.g. a reference assay). If an inhibitor is present, the high concentration samples yield higher-than-expected Ct values because the sample are not diluted.

- The baseline and/or threshold was improperly set. See your real-time PCR system user guide for procedures on setting the baseline and threshold. We recommend switching from an automatic baseline to a manual baseline (or vice versa), and/or lowering the threshold value to fall within the appropriate range.

Why are the amplification curves shaped differently for different samples with the same TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The baseline was set improperly. We recommend switching from an automatic baseline to a manual baseline (or vice versa), and/or increasing the upper or lower value of the baseline range.
Please see your real‑time PCR system user guide for procedures on setting the baseline.
- The gDNA quality was poor. We recommend that you perform a quality check on the gDNA, then re-extract the gDNA if needed.
- There were difference concentrations caused my imprecise pipetting. Please follow accurate pipetting practices.
- The reagents or equipment are contaminated. Please ensure that your workspace and equipment are cleaned properly.

Why does the amplification curve show weak amplification for the samples in my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- There is a sequence mismatch between the target region and the copy number assays. We recommend that you perform bioinformatics analysis, or select another assy from the same genomic region, if available.
- The reagents or the assays are degraded. Ensure that the kits and reagents have been stored according to the instructions on the packaging and that they have not expired. We recommend that you dilute the 60x assay to a 20x working stock to avoid excessive freeze-thaw cycles.
- The gDNA template is degraded or contaminated. Follow established PCR good laboratory practices.
- Inhibitors are present in the reaction. To confirm the presence of an inhibitor, we recommend that you run a serial dilution of your sample with an assay known to detect a target in the sample (e.g. a reference assay). If an inhibitor is present, low concentrations yield higher-than-expected Ct values because the sample is not diluted.

Why does the amplification curve show a rising baseline for samples in my TaqMan Copy Number Assay?

There may be interaction between the primer and probe. We recommend that you adjust the threshold manually, or select another assay from the same gene, if available. Alternatively, there may be bubbles in a well. In this case, we recommend that you repeat the assay with new reagents and centrifuge the reaction plate to ensure that it does not contain bubbles.

Why does the amplification curve show an abnormal plot and/or low ΔRn values for samples in my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The baseline was set too high and some samples have Ct values lower than the baseline stop value. We recommend that you switch from manual to automatic baselining, or move the baseline stop value to a lower Ct. The baseline stop value should be set to a Ct 2 cycles before the amplification curve crosses the threshold. See your real‑time PCR system user guide for procedures on setting the baseline.
-No baseline can be set because the amplification signal is detected too early in the PCR cycles. We recommend that you use a gDNA concentration within the recommended range, and dilute the sample to increase the Ct value if needed.

There was a small ΔRn for samples in my TaqMan Copy Number Assay?

A small ΔRn can mean that the PCR efficiency was poor. Ensure that the reagents were used at the correct concentration. Alternatively, the quantity of gDNA may be low (a low copy number of the target). In this case, we recommend that you increase the quantity of the gDNA in the reaction.

Why did the Rn value shift during the early PCR cycles (cycles 0 to 5) for my TaqMan Copy Number Assay?

Most likely the fluorescence did not stabilize to the buffer conditions of the reaction mix.
Note: This condition does not affect PCR or the final results.
We recommend that you reset the lower value of the baseline range or use an automatic baseline.

Why is the Rn in the Rn vs. Cycle plot so high for my TaqMan Copy Number Assay?

Most likely the ROX dye was not set as the passive reference. Set ROX dye as the passive reference, then reanalyze the data.

Why does the amplification plot show a high level of noise for my TaqMan Copy Number Assay?

Most likely the incorrect dye is set as the passive reference. Change the passive reference to the correct dye, then reanlyze the data.

Why do the amplification curves for samples appear as sigmoidal curves with my TaqMan Copy Number Assay?

When automatic baseline is used, the software selects baseline cycle values that are too narrow.
We recommend that you try the following:
-Change the analysis setting to allow manual adjustment, then set the Baseline Start Cycle to 3 and the Baseline End Cycle to 15.
- Set the Amplification Plot's graph type to linear. If amplification appears to begin earlier than cycle 15, adjust the Baseline End Cycle to 2 cycles prior to the start of amplification.
For example, if the amplification appears to begin at cycle 13, set the Start Cycle to 3 and End Cycle to 11.