Search
LOADING 
- SNP ID:
- rs140221683
- Gene
-
JMJD8LOC105371184RHBDL1RHOT2STUB1WDR24 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.16: 682438 - 682438 on Build GRCh38
- Polymorphism:
- A/G, Transition substitution
- Context Sequence [VIC/FAM]:
AGCTCATCCCCAACTTGGCTATGAA[A/G]GAGGTTATTGACGCATTCATCTCTG
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603264
MIM: 613889
MIM: 607207
|
||||||||||||||||||||
Literature Links: |
JMJD8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| JMJD8 - jumonji domain containing 8 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001005920.2 | 1273 | UTR 3 | NP_001005920.2 | |||
| NM_001323918.1 | 1273 | UTR 3 | NP_001310847.1 | |||
| NM_001323919.1 | 1273 | UTR 3 | NP_001310848.1 | |||
| NM_001323920.1 | 1273 | UTR 3 | NP_001310849.1 | |||
| NM_001323922.1 | 1273 | UTR 3 | NP_001310851.1 | |||
| LOC105371184 - uncharacterized LOC105371184 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| RHBDL1 - rhomboid like 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| RHOT2 - ras homolog family member T2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| STUB1 - STIP1 homology and U-box containing protein 1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001293197.1 | 1273 | Silent Mutation | AAA,AAG | K,K 215 | NP_001280126.1 | |
| NM_005861.3 | 1273 | Silent Mutation | AAA,AAG | K,K 287 | NP_005852.2 | |
| WDR24 - WD repeat domain 24 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top