Search
Search

ART3
CXCL10
CXCL9
LOC101928809ATCTCTATGTGGGGAGGAGACACTG[C/G]AGAATTTTAACTAAGGGAATAACAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
ART3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| ART3 - ADP-ribosyltransferase 3 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001130016.2 | Intron | NP_001123488.1 | ||||
| NM_001130017.2 | Intron | NP_001123489.1 | ||||
| NM_001179.5 | Intron | NP_001170.2 | ||||
| XM_005262997.1 | Intron | XP_005263054.1 | ||||
| XM_005262999.1 | Intron | XP_005263056.1 | ||||
| XM_005263003.1 | Intron | XP_005263060.1 | ||||
| XM_005263004.1 | Intron | XP_005263061.1 | ||||
| XM_006714220.1 | Intron | XP_006714283.1 | ||||
| XM_011531971.1 | Intron | XP_011530273.1 | ||||
| XM_017008206.1 | Intron | XP_016863695.1 | ||||
| XM_017008207.1 | Intron | XP_016863696.1 | ||||
| XM_017008208.1 | Intron | XP_016863697.1 | ||||
| XM_017008209.1 | Intron | XP_016863698.1 | ||||
| XM_017008210.1 | Intron | XP_016863699.1 | ||||
| CXCL10 - C-X-C motif chemokine ligand 10 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| CXCL9 - C-X-C motif chemokine ligand 9 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| LOC101928809 - uncharacterized LOC101928809 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||