Search
Search
View additional product information for TaqMan™ Advanced miRNA Assay - FAQs (A25576)
22 product FAQs found
An alias is the miRBAse ID for a given miRNA from an earlier version. Alias information is found in the Details section of the search results. The miRBase release version shown in parentheses represents when the alias miRBase ID was last listed.
An assay for a human miRNA may have a lower species name because the target sequence was first introduced and published in miRBase for that species and only later found in human. For example, mmu-miR-124a was first introduced as a mouse miRNA. The human miRNA was introduced later.
Accession numbers are unique identifiers assigned to both hairpin (e.g.: MI0000015) and mature (e.g.: MIMAT0000029) sequences. While miRBase names may change, the accession numbers are stable and remain associated with a specific sequence.
The mirBase ID is the official miRBase name given to a mature miRNA sequence. There may be multiple miRBase IDs for a given mature miRNA sequence because many miRNAs are conserved across species (for example, several hundred human miRNAs have the identical sequence in common with the mouse species). The miRBase ID consist of a 3 letter species identifier, including the first letter of the genus and the first two letters of the species, followed by the expression “miR”, and then a numeric suffix, e.g.: hsa-miR-212. Since two distinct mature miRNAs can be derived from the different arms of the same stem-loop precursor, a -5p or -3p suffix specifies the particular arm of the stem from which they come, e.g.: hsa-miR-501-5p is derived from the 5' end of the stem, while hsa-miR-501-3p is derived from the 3' end. The miRNA gene and hairpin precursor locus name is given lower case: hsa-mir-212. If a mature miRNA is predicted to be expressed from more than one hairpin precursor, then a numeric suffix is added to the precursor name. For example, hsa-miR-101 is expressed from two precursor loci, hsa-mir-101-1 and hsa-mir-101-2. Closely related miRNAs are given lettered suffixes (hsa-miR-19a-3p and hsa-miR-19b-3p) and are expressed from similarly named precursors (hsa-mir-19a-3p and hsa-mir-19b-3p).
miRBase continues to re-annotate the miRNA sequences as more information becomes available. Updated versions of miRBase are released on a regular basis. At the time of print (June 2013), it was up to v20.
Yes. Like our other TaqMan assays, the miRNA assays are shipped at ambient temperatures and are stable for multiple days.
Find additional tips, troubleshooting help, and resources within our TaqMan Protein Assay Support Center.
All predesigned TaqMan Advanced MiRNA assays use FAM at the 5' end of the probe as a reporter.
Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.
Yes, we have tested the advanced miRNA assays on FFPE samples. We have a collaboration with Dr. Judson at UCSF who has used the advanced assays to study miRNA expression in melanoma. Dr. Judson has presented his work in a webinar.
We have not tested this kit with the TaqMan Advanced miRNA Assay. We have also not tested blood as sample to use directly with the TaqMan Advanced miRNA cDNA Synthesis Kit. Blood usually has a lot more impurities compared to serum or plasma, so it would be best to extract RNA from blood followed by the TaqMan Advanced cDNA synthesis reaction.
Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.
They are ~60bps.
Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.
When stored at -20°C, TaqMan Advanced miRNA assays are stable for at least 5 years from the manufacturing date. The assays remain stable for at least 10 freeze-thaw cycles without compromising their functional performance.
Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.
The TaqMan Advanced miRNA workflow comprises five steps. Steps 1-4 are completed using the TaqMan Advanced miRNA cDNA Synthesis kit (Cat. No. A28007). Please check the protocol in the TaqMan Advanced miRNA Assays User Guide. Step 5 is completed using the TaqMan Advanced miRNA Assays (Cat. No. A25576) together with the TaqMan Fast Advanced Master Mix (Cat. No. 4444556, sold separately). Briefly, the steps are as follows:
Both assays use, by default, FAM as a dye and NFQ-MGB as a quencher.
If you are performing your analysis with the TaqMan Advanced miRNA Assay (Cat. No. A25576), we do not offer an alternative and the cDNA has to be synthesized with that kit.
We recommend using the same thermal profile as listed for the 7500 and 7500 Fast systems (Table 8) in the TaqMan® Advanced miRNA Assays User Guide: https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2F100027897_TaqManAdv_miRNA_Assays_UG.pdf
For TaqMan advanced miRNA assays, the templates for exogenous controls, such as ID: cel-miR-39-3p should be ordered separately as custom RNA oligos (https://www.thermofisher.com/order/catalog/en/US/adirect/lt?cmd=ConfigureRNASingleTube) using the mature sequences of the assays. Please use the following settings for ordering:
- Select siRNA from drop down menu
- For Sense Sequence, input mature miRNA target sequence of the assay - refer to page 9 of TaqMan Advanced miRNA Assays user guide (https://tools.thermofisher.com/content/sfs/manuals/100027897_TaqManAdv_miRNA_Assays_UG.pdf)
- Sense 5' modification: Phosphate
- 3' overhang: None
- Scale: 20 nmole
- Purity: Desalted
The non-human miRNAs listed below can be used as exogenous (spike-in) controls to monitor extraction efficiency or sample input amount for difficult samples (e.g. serum/plasma, or other biofluids). The final concentration of the spike-in control in your test sample should be 1-10 pM. Spike-in controls must be 5'-phosphorylated and can be ordered as custom RNA oligos at: https://www.thermofisher.com/order/catalog/en/US/adirect/lt?cmd=ConfigureRNASingleTube. TaqMan Advanced miRNA assays are available for a number of miRNAs that can be used as spike-in controls with human, mouse, and rat samples as listed below.
miRNA name, Target sequence, Assay ID
1. ath-miR159a, UUUGGAUUGAAGGGAGCUCUA, Assay ID: 478411_mir
2. cel-lin-4-5p, UCCCUGAGACCUCAAGUGUGA, Assay ID: 478289_mir
3. cel-miR-2-3p, UAUCACAGCCAGCUUUGAUGUGC, Assay ID: 478291_mir
4. cel-miR-238-3p, UUUGUACUCCGAUGCCAUUCAGA, Assay ID: 478292_mir
5. cel-miR-39-3p, UCACCGGGUGUAAAUCAGCUUG, Assay ID: 478293_mir
6. cel-miR-54-3p, UACCCGUAAUCUUCAUAAUCCGAG, Assay ID: 478410_mir
7. cel-miR-55-3p, UACCCGUAUAAGUUUCUGCUGAG, Assay ID: 478295_mir
With the exception of the U6 assay (assay ID: 001973), we do not recommend using any other small RNAs as endogenous controls for the TaqMan Advanced miRNA Assay. This is because these small RNAs lack the 5' phosphate that is required for addition of the ligation adaptor. We have several suggested human miRNA endogenous controls for the TaqMan Advanced miRNA assay and they can be found in the TaqMan Advanced miRNA Assays User Guide (https://tools.thermofisher.com/content/sfs/manuals/100027897_TaqManAdv_miRNA_Assays_UG.pdf).
The miRNAs listed below are known to be expressed at relatively constant levels across many different tissue types. These miRNAs may work as good endogenous controls for your sample and experimental condition. However, one should validate these controls since there is no universal miRNA that works across all sample types and experimental conditions. Please refer to our White Paper found here (https://www.thermofisher.com/content/dam/LifeTech/Documents/PDFs/miRNA-controls-WhitePaper.pdf)
1. hsa-miR-361-5p, Assay ID: 478056_mir
2. hsa-miR-186-5p, Assay ID: 477940_mir
3. hsa-miR-26a-5p, Assay ID: 477995_mir
4. hsa-miR-191-5p, Assay ID: 477952_mir
5. hsa-miR-451a, Assay ID: 478107_mir
6. hsa-miR-423-5p, Assay ID: 478090_mir
7. hsa-miR-320a, Assay ID: 478594_mir
TaqMan Advanced miRNA Assay was validated with TaqMan Fast Advanced Master Mix (Cat. No, 4444557) and our claims are based on the results with it. There is no technical reason why TaqMan Gene Expression Master Mix and TaqMan Universal Master Mix wouldn't work. They may be slightly less sensitive and will take a longer time to run.
We recommend using TaqMan Fast Advanced Master Mix, Cat. No. 4444557.
miR-Amp is a 30-minute universal amplification that uses 14 cycles of PCR to provide a 3-10 Ct improvement in sensitivity (depending on sample type). mir-Amp uses universal primers that recognize regions of the cDNA outside of the miRNA target sequence. These sequences are added onto all mature miRNAs in the sample during the cDNA synthesis workflow. The miR-Amp step does not introduce bias.
TaqMan Advanced miRNA Assay workflow has a universal RT and a universal pre-amplification step (miR-Amp). The first-generation TaqMan MicroRNA Assay workflow uses an miRNA-specific stem loop RT primer and has an optional pre-amplification step that is not built into the workflow but is sold separately. The main difference between these products is shown below:
TaqMan MicroRNA Assay:
- RT chemistry: Employs target-specific stem-loop primer during cDNA synthesis
- Pre-amplification: Not built into the workflow
- Throughput: Best for 1-10 targets
- Coverage: 205 species available; coverage for miRBase v21
- Format: Individual tubes, TaqMan array cards and plates, and OpenArray plates
TaqMan Advanced miRNA Assay:
- RT Chemistry: Employs a universal RT primer during cDNA synthesis
- Pre-amplification: Built into the workflow
- Throughput: Best for > 10 targets
- Coverage: Only human species is currently available; coverage for miRBase v21
- Format: Individual tubes, TaqMan array cards and plates, and OpenArray plates